Top
IDMSMg01-541J08
Information of forward sequence (DDBJ: AG607564)
Chromosome X position(base) 50266154 - 50266865 strand +
Alignment
seq1: chrX_50266154_50266865
seq2: MSMg01-541J08.T7_58_765

seq1  GAATTCCAGAGACTTGGCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGAGACTTGGCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50

seq1  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100

seq1  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTAGGAGGCTAGTGTGC  150
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTGGGAGGCTAGTGTGC  150

seq1  GATTGGGGAATACATAACGGAGAGAATCCGCTCTGTTTCCTGCCTGGTCC  200
      |||||||||||||||||||||| ||||||||||||||||||| |||||||
seq2  GATTGGGGAATACATAACGGAGGGAATCCGCTCTGTTTCCTGTCTGGTCC  200

seq1  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250

seq1  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300

seq1  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350

seq1  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400

seq1  GTTTCCTTTTGAATAACCGCAAAAAAAAAAAAAAAAAAAGCAGTGCGAAG  450
      ||||||||||||||||||||    ||||||||||||||||||||||||||
seq2  GTTTCCTTTTGAATAACCGC----AAAAAAAAAAAAAAAGCAGTGCGAAG  446

seq1  CATGTAATAATATCGTGCAACCAAATTCAGGTGCCCTTCCGGTACATTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTAATAATATCGTGCAACCAAATTCAGGTGCCCTTCCGGTACATTTC  496

seq1  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGAGAGAAAGACCGTGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGAGAGAAAGACCGTGT  546

seq1  TATCTTTGGAGGATCGCACTTATATCTGTGAATTTCAACTGGCTTGCATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTTTGGAGGATCGCACTTATATCTGTGAATTTCAACTGGCTTGCATG  596

seq1  CGGAAGGTTTTTCATCTTCCGGAACTGCAGTTTTGTTTTGTTTGTTTTTT  650
      |||||||||||||||||||||||||||||| ||||| |||||||||||||
seq2  CGGAAGGTTTTTCATCTTCCGGAACTGCAGNTTTGTNTTGTTTGTTTTTT  646

seq1  TCGGTAGAAAACGTTCTTTTAAGATACTAGCCATTGACTAAGCTCTCGAG  700
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TCGGTAGAAAACGTTCTTTTAAGATGCTAGCCATTGACTAAGCTCTCGAG  696

seq1  TTGGTTCTCGAA  712
       |||||||||||
seq2  ATGGTTCTCGAA  708

Information of reverse sequence (DDBJ: AG607565)
Chromosome X position(base) 50441218 - 50441895 strand -
Alignment
seq1: chrX_50441218_50441895
seq2: MSMg01-541J08.TJ_54_731 (reverse)

seq1  TTCATTCTACTGTTGGCCACAGAAAGCTCCTCAATGGCTATCCAGATCTA  50
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTCTACTGTTGGCCACAGAAAGCTCCTCAATGGCTATCCAGATCTA  50

seq1  ATCCCAACCATCATTTTGAGATCCTCCTCTTGTTTTGTCACCAAGCCGCA  100
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  ATCCCAACCATCATTTTGAGATCCTCCTCATGTTTTGTCACCAAGCCGCA  100

seq1  GTGTGCTATACAATGGATCCATTATTTTACTTTGATTTTTCATGTAGTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGCTATACAATGGATCCATTATTTTACTTTGATTTTTCATGTAGTAT  150

seq1  ATGAAAGAAATATTAGCACCAGGTTTTGCCATGAAAGCAAACAAGAGAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAGAAATATTAGCACCAGGTTTTGCCATGAAAGCAAACAAGAGAAG  200

seq1  ACACCTATATACACAGGTAGATGAACACAAAGCCTGGACCTGCACGCTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTATATACACAGGTAGATGAACACAAAGCCTGGACCTGCACGCTAA  250

seq1  CCTTCAGAGGGTCTGAGGCTGGGGAGTGTAGTCTTCGTAGGTGATAGTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAGAGGGTCTGAGGCTGGGGAGTGTAGTCTTCGTAGGTGATAGTTA  300

seq1  TGAACCTTAAGTGCTATGGCTTCTCTAGGTCCCTCCTAAGCAACATTTCT  350
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  TGAACCTTAAGTGCTATGGCTTCTCTATGTCCCTCCTAAGCAACATTTCT  350

seq1  GTTCTGACATTTGTTTCAAATAAGTTTTCCTTCCAGAAAATTACCACTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGACATTTGTTTCAAATAAGTTTTCCTTCCAGAAAATTACCACTTA  400

seq1  GGGCCACACAGAAGATGGGTTTGACTTTGCCTAGGTGTGAAATATTTTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCACACAGAAGATGGGTTTGACTTTGCCTAGGTGTGAAATATTTTGT  450

seq1  TGGATGTGCTGATTTTCATACTGCAGTGATGGAAAATTACTATACATTTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATGTGCTGATTTTCATACTGCAGTGATGGAAAATTACTATACATTTA  500

seq1  ATGAATTGCCTGCACGGTGACCTCTCAACACAGGAGCAATGGCTTCAGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATTGCCTGCACGGTGACCTCTCAACACAGGAGCAATGGCTTCAGTC  550

seq1  TTTACCTCTTGTTCCCTATGAATTCTTAACCTCAATTTCACCCCAATCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACCTCTTGTTCCCTATGAATTCTTAACCTCAATTTCACCCCAATCCC  600

seq1  CCTTTACCCACAAATTCTGCAAAACATCCTCTCTCCAAATAAAAACAACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTACCCACAAATTCTGCAAAACATCCTCTCTCCAAATAAAAACAACA  650

seq1  AGGAACTGGGACTAGAGGGTGAGAATTC  678
      ||||||||||||||||||||||||||||
seq2  AGGAACTGGGACTAGAGGGTGAGAATTC  678