Top
IDMSMg01-521K22
Information of forward sequence (DDBJ: AG592421)
Mapping result un_mapped (repeat)
BAC sequence
Information of reverse sequence (DDBJ: AG592422)
Chromosome X position(base) 50377638 - 50377760 strand -
Alignment
seq1: chrX_50377638_50377760
seq2: MSMg01-521K22.TJ_546_666 (reverse)

seq1  AGCAACCACATGGTGGCTCATAACACTCAGCAACCACGTGGTGGCTCACA  50
                                  ||||||||| ||||||||||||
seq2  ----------------------------AGCAACCACATGGTGGCTCACA  22

seq1  ACCATCTGGAATGGGATTTGATTCCCTCTTGTGGTGTGTCTGA--AAAGG  98
      |||||||| ||||| || |||| ||||||| ||||||||||||  | || 
seq2  ACCATCTGTAATGGAATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGT  72

seq1  GAC------------------------ATAAATAAATCTTTTTTAAAAA  123
      |||                        |||||||||||||||| |||||
seq2  GACAGTGTACTCACATTCATAAAATAAATAAATAAATCTTTTTAAAAAA  121