Top
IDMSMg01-509H19
Information of forward sequence (DDBJ: AG583151)
Chromosome X position(base) 50186045 - 50186680 strand +
Alignment
seq1: chrX_50186045_50186680
seq2: MSMg01-509H19.T7_61_735

seq1  CTTCCTCTGCCTCCCAAGTGTTGGGAACAAAAGCATGAGCCACCATACCT  50
      ||||||||||||  ||||||||||            ||||||||||||||
seq2  CTTCCTCTGCCTGGCAAGTGTTGG------------GAGCCACCATACCT  38

seq1  GAATCATTTACTCATAAATGCTTCTGCTCATGACCTGCTACTCCTCTAAT  100
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  GAATCATTTACTCATAAATGCTTCTGCTCATGACCTGCCACTCCTCTAAT  88

seq1  GTAAACACGCATTCAATAACTCAACCTGTGCCAAATATTCCTATAATGTA  150
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACACGCATTCAATAACTCAACCTGTGCCAAATATTCCTATAATGTA  138

seq1  AAACATCAGGCTTCTGAGTGAGTCCCGAGATATCCCCTCCTCATAGGAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATCAGGCTTCTGAGTGAGTCCCGAGATATCCCCTCCTCATAGGAAA  188

seq1  CCATTTTCTTGTCCTTTCTATTGTTTAAATCAACTAATATACTCATGATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTCTTGTCCTTTCTATTGTTTAAATCAACTAATATACTCATGATT  238

seq1  AAAAAATAAGGTGTATATAAGATGGCACACATTAGCAAGTCTCACCCTCT  300
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  AAAAAATAAGGTGTATATTAGATGGCACACATTAGCAAGTCTCACCCTCT  288

seq1  TGTCTCTTTCCCC-CTTTTTTCCTGCTGTTCTCCATGTGTTTATGTACAT  349
      |||||||||||||  |||||||||||||||||||||||||||||||||||
seq2  TGTCTCTTTCCCCTTTTTTTTCCTGCTGTTCTCCATGTGTTTATGTACAT  338

seq1  TTATTTTCTTGTTCACTTGTTCCACAAAAGTTGATCACACTAACCAGTGT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTTCTTGTTCACTTGTTCCACAAAAGTTGATCACACTAACCAGTGT  388

seq1  CCTGTACCTTCCTTTAGAAGTGTTGTATTTACAGTTACTTTTCCACAATG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTACCTTCCTTTAGAAGTGTTGTATTTACAGTTACTTTTCCACAATG  438

seq1  GGTTGCCTTGTGGTAAAATGATGCCTATACTCTGGACACAGACTACCTTT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGCCTTGTGGTAAAATGATGCCTATACTCTGGACACAGACTACCTTT  488

seq1  GTGGACTTTTCCCTCTGAACCC----------------------------  521
      ||||||||||||||||||| ||                            
seq2  GTGGACTTTTCCCTCTGAATCCATATATATATATATATATATATATATAT  538

seq1  ----------------------ATATATATATATTGGTAAAATTTCTATG  549
                            ||||||||||||||| |||| ||| |||
seq2  ATATATATATATATATATATATATATATATATATTGGGAAAAATTCNATG  588

seq1  CATTTCTCTTCCCAAATATTTGTATTTATACTTTGGTGTTTATTTATGTA  599
      |  ||||||||||||||| ||||||||||||||||||||||||||||| |
seq2  CTATTCTCTTCCCAAATAATTGTATTTATACTTTGGTGTTTATTTATGAA  638

seq1  TTTGAGATAAGATGTCATATATCCCAGGGTGGTCTTA  636
      |||||||||| | ||||||||||||| |||| |||||
seq2  TTTGAGATAACACGTCATATATCCCACGGTGTTCTTA  675

Information of reverse sequence (DDBJ: AG583152)
Chromosome X position(base) 50322288 - 50323010 strand -
Alignment
seq1: chrX_50322288_50323010
seq2: MSMg01-509H19.TJ_72_779 (reverse)

seq1  TTTTTAAAAAATGAAATAAAGAGAAAAAAAAAAAGAAAGGTTTTATGATC  50
      |||||||||||||||||||||||  | |||||| |   | ||||||||||
seq2  TTTTTAAAAAATGAAATAAAGAG--AGAAAAAAGGNGTGTTTTTATGATC  48

seq1  CAAAAAGCCAGGTACTGAATTTGAATGTTCGAAGTTAGAATCTGGGCAGT  100
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  CAAAAAGCCAGGTACTGAATTTGAATGTTCGCAGTTAGAATCTGGGCAGT  98

seq1  ATTATGTTTCTCCTGCTCTCTGCCTCCTTGAGCTCTGTGAGTTCAAGGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATGTTTCTCCTGCTCTCTGCCTCCTTGAGCTCTGTGAGTTCAAGGCC  148

seq1  AGCCTGGTGCACATAGTGAGTTCCAGGCCACCTTATGCTACAACTTTTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGGTGCACATAGTGAGTTCCAGGCCACCTTATGCTACAACTTTTAT  198

seq1  ACAAATGTTCTCTTATACCTATTAAGCTTTTTTCCACTTAGAAATTGCAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATGTTCTCTTATACCTATTAAGCTTTTTTCCACTTAGAAATTGCAA  248

seq1  TCTTTTCCTAGGTCATAATATAAACTCTTTGTTTGTTTGTTTGTTTTTTG  300
      ||||||||||||||||||||||||||||||             |||||| 
seq2  TCTTTTCCTAGGTCATAATATAAACTCTTT-------------TTTTTTT  285

seq1  TTTGTTTGTTTTTTGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGC  350
      ||| ||| |     ||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTNNNAGGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGC  335

seq1  TGTCCTGGAACTCACTCTGTAGACCAGGCTGGTCTCGAACTCAGAAATCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTGGAACTCACTCTGTAGACCAGGCTGGTCTCGAACTCAGAAATCC  385

seq1  GCCTGCCTCTGCTTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACGC  450
      |||||||||||||||||||||||||||| ||| |||||| |||||||| |
seq2  GCCTGCCTCTGCTTCCCAAGTGCTGGGACTAAGGGCGTGCGCCACCACAC  435

seq1  CCGGCTAATATAAACTCTTATTCTTACCGACTATCTAATAATCAATTATG  500
      |||||||||||||||||||||| |||||||||||||||||||||||| ||
seq2  CCGGCTAATATAAACTCTTATTATTACCGACTATCTAATAATCAATTGTG  485

seq1  TAGCTGTATCATACATTGTCTCATGAGACATTTGAATACTTTTCAGCTTT  550
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TAGCTGTATCATACTTTGTCTCATGAGACATTTGAATACTTTTCAGCTTT  535

seq1  CATAGTTGCTATTTTGGTATTTCAAGCAGACCATTTCAAATCACAAAGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGTTGCTATTTTGGTATTTCAAGCAGACCATTTCAAATCACAAAGAA  585

seq1  ATAGCAGAAACCCACAAATTGAAGTTTGTTCTATATGATCACTGGCCTGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCAGAAACCCACAAATTGAAGTTTGTTCTATATGATCACTGGCCTGA  635

seq1  ACACCTCAAAAAAGACTTGAAAAACTGAGAGAGGCTTAGGATCTGTTTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTCAAAAAAGACTTGAAAAACTGAGAGAGGCTTAGGATCTGTTTGA  685

seq1  AATAAATAGTGACAAAGGGACAG  723
      ||||||| |||||||||||||||
seq2  AATAAATGGTGACAAAGGGACAG  708