Top
IDMSMg01-508B18
Information of forward sequence (DDBJ: AG582099)
Chromosome X position(base) 50273655 - 50274334 strand -
Alignment
seq1: chrX_50273655_50274334
seq2: MSMg01-508B18.T7_54_725 (reverse)

seq1  TTGGTAGAGCACACCTTTAATCCCAGCACTTTGGAGGCAGAAGCAGGTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTAGAGCACACCTTTAATCCCAGCACTTTGGAGGCAGAAGCAGGTGG  50

seq1  ATGTCTGTGAGTTCAAGGCCAACCTGATCTACAAATGGACTCCAGGAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCTGTGAGTTCAAGGCCAACCTGATCTACAAATGGACTCCAGGAAAG  100

seq1  CCAGGGCTACACAAAGAAACCCTGTCACCCCCCCCCCAAAAAAAAAAAAA  150
      |||||||||||||||||||||||||||||||||||||      |||||||
seq2  CCAGGGCTACACAAAGAAACCCTGTCACCCCCCCCCC------AAAAAAA  144

seq1  AACTTTAACTAACTAAATAAAATATATAGGCCCAAGATATAGGAAGAAAA  200
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  AACTTTAACTAACTAAATAAAATATATAGGCCCGAGATATAGGAAGAAAA  194

seq1  AAAGAAAATAACTATTTGCAGTTCTTATTTATTTTTCCCATAATGACTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAATAACTATTTGCAGTTCTTATTTATTTTTCCCATAATGACTTC  244

seq1  CAGTTCTTTATTGAAGACATATAAGATGCCATATCTGTACTCTGTTCCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTCTTTATTGAAGACATATAAGATGCCATATCTGTACTCTGTTCCAG  294

seq1  CTATATTTTGTTTTTGAGTCAAGGTTTCATGTGACCCTGGCAGGCCTGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATATTTTGTTTTTGAGTCAAGGTTTCATGTGACCCTGGCAGGCCTGAA  344

seq1  ACTCACTGTGTAGCTGAGGGTGGCTTTGATTACTAATCCCCCTGACCCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  ACTCACTGTGTAGCTGAGGGTGGCTTTGATTACTAATCCCCCTGACCTCT  394

seq1  CTTTCCAAGTGTCGAGATATTATACGTATGTGCTGTAGCCACCTGATAAG  450
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CTTTCCAAGTGTCGAGATATTGTACGTATGTGCTGTAGCCACCTGATAAG  444

seq1  TCTATCCTTGTTCACCACGGAGACAAAAAGGTGATTTCCCAGGGAAGTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCCTTGTTCACCACGGAGACAAAAAGGTGATTTCCCAGGGAAGTTC  494

seq1  TAAGTAATGGTTGCTCGTTTGAATTTGCTGTGAGGAGACAGTGGAGCGTG  550
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TAAGTAATGGTTGCTCCTTTGAATTTGCTGTGAGGAGACAGTGGAGCGTG  544

seq1  GTATTTGATTAGAAGAATGGATTCTTTCGGAAGCACCTCGTGATAGCACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATTTGATTAGAAGAATGGATTCTTTCGGAAGCACCTCGTGATAGCACT  594

seq1  GAGATCTCAGGCTGAGAGTCACTTTTACTAATTGCTCCCTGGGTCAGGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATCTCAGGCTGAGAGTCACTTTTACTAATTGCTCCCTGGGTCAGGTC  644

seq1  AGAGAGATAACGGATGTCAAAAGAATTCCG  680
      ||||||||| ||| |  |||||| ||||||
seq2  AGAGAGATATCGGGT-ACAAAAG-ATTCCG  672

Information of reverse sequence (DDBJ: AG582100)
Chromosome X position(base) 50101325 - 50102062 strand +
Alignment
seq1: chrX_50101325_50102062
seq2: MSMg01-508B18.TJ_73_736

seq1  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAACAATTTGTATAGGAAAA  50
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAGCAATTTGTATAGGAAAA  50

seq1  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100

seq1  CTA-TTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACT  149
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACT  150

seq1  GTTAACTAAATAATATCAGTGTGAATTTGATATTAAAGATTTATCCTTTG  199
      |||||                                             
seq2  GTTAA---------------------------------------------  155

seq1  ATGAGGAAAAGAAAGCCTCACTGTATACAATTTGATAGCAAAACGCTGAA  249
                      |||||||||||||||||||||||           
seq2  ----------------CTCACTGTATACAATTTGATAGC-----------  178

seq1  AGCTAAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACG  299
          ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ----AAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACG  224

seq1  TGACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATAC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATAC  274

seq1  CTGTTATTAATTTTCTTGTAAACAAACTTTTCTTTTTTAAAGTGGTTTTT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTATTAATTTTCTTGTAAACAAACTTTTCTTTTTTAAAGTGGTTTTT  324

seq1  GTCAACATTTGATTTTTTAAAGTGTGTCTTACATTCTTACATTATTTACA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAACATTTGATTTTTTAAAGTGTGTCTTACATTCTTACATTATTTACA  374

seq1  AACATTTCTTATTTTTATTACTATGTGAATTTTGTTTTCAATTACAAAAA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTTCTTATTTTTATTACTATGTGAATTTTGTTTTCAATTACAAAAA  424

seq1  TATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGT  474

seq1  TGGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCC  524

seq1  AATTACATTATCTGTGGATCA-TTTTTTTTCTCTCTCAGCAAGCAGAAGT  648
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  AATTACATTATCTGTGGATCATTTTTTTTTCTCTCTCAGCAAGCAGAAGT  574

seq1  CATAAACAAGTTTCCTGGGACAAACAACTGTATTTTTACAACTTTAATAT  698
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAACAAGTTTCCTGGGACAAACAACTGTATTTTTACAACTTTAATAT  624

seq1  TTTAAGTCAAAGTGGATAGGCAAACATTACAAATATATAA  738
      ||||||||||||||||||||| |||||||||||||| |||
seq2  TTTAAGTCAAAGTGGATAGGCCAACATTACAAATATTTAA  664