Top
IDMSMg01-502N13
Information of forward sequence (DDBJ: AG578104)
Mapping result un_mapped (repeat)
BAC sequence
Information of reverse sequence (DDBJ: AG578105)
Chromosome X position(base) 50033519 - 50034203 strand +
Alignment
seq1: chrX_50033519_50034203
seq2: MSMg01-502N13.TJ_66_750

seq1  AATTCCAGATGTCGTCAGATTGACAACCAAGATTCACCATCATGCCAGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCCAGATGTCGTCAGATTGACAACCAAGATTCACCATCATGCCAGCT  50

seq1  TTTGATGTGGGTGCTTGATATTGAAACTCAGTCCTGACGCTTGCACTACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATGTGGGTGCTTGATATTGAAACTCAGTCCTGACGCTTGCACTACA  100

seq1  AGCACTTGAAGCACTGAGCCCTCTCCCCAGCTCCAGCAAAGGTCATTCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACTTGAAGCACTGAGCCCTCTCCCCAGCTCCAGCAAAGGTCATTCAT  150

seq1  GGCCTCTACTGCACATGTTCTTTTCTCCAGTTATAAATGAAGTCAAAGCA  200
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GGCCTCTACTGCACATGTTCTTTTCTCCATTTATAAATGAAGTCAAAGCA  200

seq1  AGAAAGCACAGACCTTCATTTTTATAAAATTTGCTATCCTGATAATAGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||| | 
seq2  AGAAAGCACAGACCTTCATTTTTATAAAATTTGCTATCCTGATAATATAT  250

seq1  GGGAAAAAGATTCAGAGCATAGTCAGAGAAAAGATCACAAAATAGTCGAC  300
      |  ||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GTTAAAAAGATTCAGAGCATAGTCAGAGAAAAGATCACAAAACAGTCGAC  300

seq1  CTCTTCAACGCCTGTACAGAAAAGCCTCTCCGGAGGAAGGCCAACAAGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCAACGCCTGTACAGAAAAGCCTCTCCGGAGGAAGGCCAACAAGGC  350

seq1  TTGCCACTGTCCAAGCACTTCTACTTATTTTAGGGACTTTAGTCTTACAA  400
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TTGCCACTGTCCAAGCGCTTCTACTTATTTTAGGGACTTTAGTCTTACAA  400

seq1  AACTGGAAAGGGCTTCTTGGTTAATTCTTTCAGCTTTACCTACTTCAGCA  450
      |||||| |||||||||| ||||||||||||||||||||||||||||||||
seq2  AACTGGCAAGGGCTTCTCGGTTAATTCTTTCAGCTTTACCTACTTCAGCA  450

seq1  AGTGACCACATAAGCCTAACAACATTATATACACACACTTCTGTGGCTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACCACATAAGCCTAACAACATTATATACACACACTTCTGTGGCTAA  500

seq1  AGATAGACATTGATGTTTATAATCAGTAATACTGTGTCTGTGTGACATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAGACATTGATGTTTATAATCAGTAATACTGTGTCTGTGTGACATAA  550

seq1  AAATGGAAAAACTGGTTTTCCACTTGTAGAAAGGGTAATTTTTGGTTTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGGAAAAACTGGTTTTCCACTTGTAGAAAGGGTAATTTTTGGTTTTT  600

seq1  TGAGAGAGGGCCACTCTGTGTAGCCTTGGCTGTCCAGCTCTGTAGAACAG  650
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  TGAGAGAGGGCCACTCTGTGTAGCCTTGGCTGTCCAGCTCTGTAGACCAG  650

seq1  GCTGGCGTCAAACTCAGAGATCCACCTGCCTCTGC  685
      ||||||||||||||| |||||||||||||||||||
seq2  GCTGGCGTCAAACTCCGAGATCCACCTGCCTCTGC  685