Top
IDMSMg01-498F13
Information of forward sequence (DDBJ: AG574695)
Chromosome X position(base) 50269205 - 50269888 strand +
Alignment
seq1: chrX_50269205_50269888
seq2: MSMg01-498F13.T7_55_736

seq1  AATTCAGTTCTCTCAATATTTTGTAGTTTTCTTTGTAGTTTTAACTTGTT  50
      ||||||||||||||  ||||||||||||||||||||||||||||||||||
seq2  AATTCAGTTCTCTC-CTATTTTGTAGTTTTCTTTGTAGTTTTAACTTGTT  49

seq1  CTTAGATCTTCATCATTCTGTTTCCTTGGTGGACATATATCTAAACTTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGATCTTCATCATTCTGTTTCCTTGGTGGACATATATCTAAACTTGA  99

seq1  AATTTATTTTTTTATCTTTAATTATACTAGTGGATGATTTAATTTTGTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTATTTTTTTATCTTTAATTATACTAGTGGATGATTTAATTTTGTGA  149

seq1  TTTTGGTTTTCTGGATGGTCCTCAGGCTCACCTTGTGGTGCAGGCAGGCC  200
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  TTTTGGTTTTCTGGATGGTCCTCGGGCTCACCTTGTGGTGCAGGCAGGCC  199

seq1  TCTTACTTATGACCTTTTACCTGAACCGAAGCTGTGTTATATATTCTTAT  250
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  TCTTACTTATGACCTTTTGCCTGAACCGAAGCTGTGTTATATATTCTTAT  249

seq1  CACACAAGAGGAATTTGATTTCACATCTTCTAATTTGGATTTATTTTGAT  300
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CACACAAGAGGAATTTGATTTCTCATCTTCTAATTTGGATTTATTTTGAT  299

seq1  TTCTCTCAATGACTCTAGATTTGATTGCTTTCTTGCCACTTCTTTTTCCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTCAATGACTCTAGATTTGATTGCTTTCTTGCCACTTCTTTTTCCC  349

seq1  TTTCTTAACATCTATTATGTATGGAAGGCATCTTGGGTTTTTGATATTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTAACATCTATTATGTATGGAAGGCATCTTGGGTTTTTGATATTTA  399

seq1  TCTCTACTAGTATTTAAGTAAACTATATTACAACCTGGGTCAGATATAGA  450
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TCTCTACTAGTATTTAAGT-AACTATATTACAACCTGGGTCAGATATAGA  448

seq1  GCTACTTGTGTGGATCCGTATAAGGTCATTTTGAATGGAAATTAACCATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTACTTGTGTGGATCCGTATAAGGTCATTTTGAATGGAAATTAACCATT  498

seq1  TTGTTGCCGTTTTTATCCTCTATAGCATTTCTTGAGGCTTAAAGTGGCAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGCCGTTTTTATCCTCTATAGCATTTCTTGAGGCTTAAAGTGGCAG  548

seq1  TCTCTAAACACTTTAAAAATCATGTCAAGCTCAATTGAACAGAAAAAAGG  600
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TCTCTAAACACTTTAAAAATCATGTCAAGCTCAATTGAACAGAATAAAGG  598

seq1  GTCTACGAGACAGCGTAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGG  650
      |||||||||||||||||||||||   ||||||||||||||| |||| | |
seq2  GTCTACGAGACAGCGTAAATGTGTGCTTTGTAAGTCAAATATAGACCAAG  648

seq1  AATGTGGACAGTTACTGAT-ATCTGAAAACCAGAA  684
      ||||||||| ||||||||| ||||| |||||||||
seq2  AATGTGGACTGTTACTGATAATCTG-AAACCAGAA  682

Information of reverse sequence (DDBJ: AG574696)
Chromosome X position(base) 50438576 - 50439285 strand -
Alignment
seq1: chrX_50438576_50439285
seq2: MSMg01-498F13.TJ_68_779 (reverse)

seq1  GAGAGCGAGAGCGAGAACAAGAG-AAAATATTCATCTACTTTCTTCCAGG  49
      ||||| |||| ||||| |||||| ||||| ||| ||| ||||||||||||
seq2  GAGAGTGAGACCGAGACCAAGAGAAAAATTTTCTTCTCCTTTCTTCCAGG  50

seq1  ATGAAGAAAGCTAGCTGCAAGGTTGGGAAATTCTTCATTCCTGTTCAAAA  99
      |  |||||||||||||||||||| |||||| |||||||||||||||||||
seq2  AGAAAGAAAGCTAGCTGCAAGGTGGGGAAA-TCTTCATTCCTGTTCAAAA  99

seq1  TCACTAGCTTGATGTGTTGTTGGTGGTGGTGGGGG-TTGAGCTGATTCCC  148
      |||||||||||||||||||||| || || |||||| ||||||||||||||
seq2  TCACTAGCTTGATGTGTTGTTGTTGTTGTTGGGGGATTGAGCTGATTCCC  149

seq1  TGCCCCCACTAAGAGCATCTCCTGGCTTCACAGGCTCTTTATGAAGAATT  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCCCACTAAGAGCATCTCCTGGCTTCACAGGCTCTTTATGAAGAATT  199

seq1  GCATATTGTTTGAGCCATCAACTTGGCTCATACGAAAAGCAGAACAACTG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATTGTTTGAGCCATCAACTTGGCTCATACGAAAAGCAGAACAACTG  249

seq1  TGGCACCCACCTGTTAGAAATCAAGACTCGGGTATTAAAACCAGAAGCGC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACCCACCTGTTAGAAATCAAGACTCGGGTATTAAAACCAGAAGCGC  299

seq1  TGGCCCATTAGAAGAGCCTGGCTCTGTTGCATGGGAGGCAAACCCCTCGT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCCATTAGAAGAGCCTGGCTCTGTTGCATGGGAGGCAAACCCCTCGT  349

seq1  AAAGCCAGGGATTAGTGTGTCCATACTGGGGCAGTGACTGAAGCAGGTGC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCAGGGATTAGTGTGTCCATACTGGGGCAGTGACTGAAGCAGGTGC  399

seq1  TCATTTTTTCCCCTGACAGCCTAGAAGTAGAAGCTGAAATAGAATAAGTT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTTTCCCCTGACAGCCTAGAAGTAGAAGCTGAAATAGAATAAGTT  449

seq1  CTCACAGGGCATGACCCCAGATAGGAGATGTGGAGGTAACTGACACTCCT  498
      |||||||  |||||||||||||||||||||||||||||||||||||||||
seq2  CTCACAGAACATGACCCCAGATAGGAGATGTGGAGGTAACTGACACTCCT  499

seq1  TGGTTTTTGATACCCCTGGAAAATGGCACGACAATCTCTTGGCACACAAT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTTTTGATACCCCTGGAAAATGGCACGACAATCTCTTGGCACACAAT  549

seq1  GGCAGCTGCCCTAGCTCTTTGGTGACGGCTGTTCTACAGAACGAGGGAGG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCTGCCCTAGCTCTTTGGTGACGGCTGTTCTACAGAACGAGGGAGG  599

seq1  AAAATGTGAAT-AAAAAATCGAGGGAATTGTGTGACAGAGGAATCAAGAA  647
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AAAATGTGAATAAAAAAATCGAGGGAATTGTGTGACAGAGGAATCAAGAA  649

seq1  CATGTTGCAAAGAGCCATCTCATTATTATTTATGAAATGAAATGGATCTC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTTGCAAAGAGCCATCTCATTATTATTTATGAAATGAAATGGATCTC  699

seq1  CATGGAGGAATTC  710
      |||||||||||||
seq2  CATGGAGGAATTC  712