Top
IDMSMg01-453L05
Information of forward sequence (DDBJ: AG540651)
Chromosome X position(base) 50414018 - 50414711 strand +
Alignment
seq1: chrX_50414018_50414711
seq2: MSMg01-453L05.T7_52_747

seq1  GAATTCTTGAATCTGCCTCTCTCCTACCAACCAGGCTCTCACCAGAGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGAATCTGCCTCTCTCCTACCAACCAGGCTCTCACCAGAGAAA  50

seq1  CCATTTTGCCTCTCTACCAAGAAGAGCCTTAGAAACTCATTGATGCTCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTGCCTCTCTACCAAGAAGAGCCTTAGAAACTCATTGATGCTCAC  100

seq1  GGTTTTTGATCTCAAGATTTCTTTTTCCCTTTCCAAAGATGCGCATGCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTTGATCTCAAGATTTCTTTTTCCCTTTCCAAAGATGCGCATGCTC  150

seq1  ACTGCCTGCAATAGCTATGTCCTCTTACTATCTTAAGAATGTCTGCCCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCTGCAATAGCTATGTCCTCTTACTATCTTAAGAATGTCTGCCCAT  200

seq1  TAAACTGAAAACAATTTCAGATTCCAGAAGTGATTGATCGATCTTCACAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACTGAAAACAATTTCAGATTCCAGAAGTGATTGATCGATCTTCACAA  250

seq1  GAACCAGGCCCACAGTGGAGGGACATCTTAGTGTTCCTGTGTGACTGCCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCAGGCCCACAGTGGAGGGACATCTTAGTGTTCCTGTGTGACTGCCC  300

seq1  TAGCTGTGGTTGGAATTTGATCTCTAGTCAGGGGCAACTGACAAAGTTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGTGGTTGGAATTTGATCTCTAGTCAGGGGCAACTGACAAAGTTTA  350

seq1  AGAAGAGGCACTTGGAGATAGTAAACCTGTGGCCATATAAGCGGAGGCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGGCACTTGGAGATAGTAAACCTGTGGCCATATAAGCGGAGGCAT  400

seq1  TTAGTTTCAAACTCGACACTTCTTCCATTTTCCTGGAATCTCATCTAATT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTTCAAACTCGACACTTCTTCCATTTTCCTGGAATCTCATCTAATT  450

seq1  AGGAAAAAGAGAAGGAAGAAAAAACACTCTACTATCTATCAATGTCACCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAAAGAGAAGGAAGAAAAAACACTCTACTATCTATCAATGTCACCC  500

seq1  TGCCAAATGTGTTCAGGGAGGCAGAAGTGAGTTTGGACAGTTGGCTGGTT  550
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  TGCCAAATGTGTTCAGGGAGGCGGAAGTGAGTTTGGACAGTTGGCTGGTT  550

seq1  GCTCCATTTATATT--AAAAAAAAGTCAAAGGAAAAGAAAACCCCAACAA  598
      ||||||||||||||  ||||||||||||||||||||||||||||||||||
seq2  GCTCCATTTATATTAAAAAAAAAAGTCAAAGGAAAAGAAAACCCCAACAA  600

seq1  ATTCTAAACAATACAACAACCTCAAATGAACAAGCTGATAGACAGAGTGA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTAAACAATACAACAACCTCAAATGAACAAGCTGATAGACAGAGTGA  650

seq1  CTGACTCAAGGAAGTCCTGAAATCCTGTTAAAAGTGCAGTGTTCTG  694
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTCAAGGAAGTCCTGAAATCCTGTTAAAAGTGCAGTGTTCTG  696

Information of reverse sequence (DDBJ: AG540652)
Mapping result un_mapped
BAC sequence