Top
IDMSMg01-451I15
Information of forward sequence (DDBJ: AG539004)
Chromosome 4 position(base) 133393285 - 133393981 strand +
Alignment
seq1: chr4_133393285_133393981
seq2: MSMg01-451I15.T7_54_751

seq1  TCCAGGACAGCCAGGGCTATACAGAGAAACCCT-GTCTCCAAAAAAAAAA  49
      |||||||   ||  ||||||||||||||||||| | ||||||||||||||
seq2  TCCAGGATTTCC-CGGCTATACAGAGAAACCCTGGGCTCCAAAAAAAAAA  49

seq1  AAAAAAACAAAAAAAAAACAAAAAAAAAAACCAAAACAAAACCCAAAACG  99
      ||||||  |||||||||||||||||||||| |||||||||||||||||||
seq2  AAAAAACAAAAAAAAAAACAAAAAAAAAAAACAAAACAAAACCCAAAACG  99

seq1  AAAGATGTGACAAAAGGTTCCCAAGAGCAGAAGCACATAGAAATAGTGAG  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATGTGACAAAAGGTTCCCAAGAGCAGAAGCACATAGAAATAGTGAG  149

seq1  TTTGTGAGAAAGGCTCACTAATGTTCATCACCAGGAAATGAATACTAAAC  199
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  TTTGTGAGAAAGGCTCACTAATGTTCGTCACCAGGAAATGAATACTAAAC  199

seq1  TCACAAAGAGAAACCACTCCACACCCACCAGTGTGACTATATTTAAAACA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAAAGAGAAACCACTCCACACCCACCAGTGTGACTATATTTAAAACA  249

seq1  ACTGATACCACAGTCTAAGCC-CAGGTGTCCAACCTTGTGACACTTCAAC  298
      |||||||||||||||||||||  |||||||||||||||||||||||||||
seq2  ACTGATACCACAGTCTAAGCCTTAGGTGTCCAACCTTGTGACACTTCAAC  299

seq1  CTGGTTTTGTCATCTACACGTGTGTTGGGCCTCGTTCATAGACTGCCTTG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTTTGTCATCTACACGTGTGTTGGGCCTCGTTCATAGACTGCCTTG  349

seq1  GACCCCTGTAGCCAGTTAGAGACACTGGAAGATCATGCATTCCTGGTAGG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCCTGTAGCCAGTTAGAGACACTGGAAGATCATGCATTCCTGGTAGG  399

seq1  AAAGGAAAGTGGTCACTTTGGAAAACATTATATACATGAATTTCTCTGTG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAAGTGGTCACTTTGGAAAACATTATATACATGAATTTCTCTGTG  449

seq1  TAGCCCTGGCTGCCCTGGGAACTCACTCTGTAGACCAGGCTGGTCTTGAA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCCTGGCTGCCCTGGGAACTCACTCTGTAGACCAGGCTGGTCTTGAA  499

seq1  CTCAGAGATCCACCTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGTATA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGATCCACCTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGTATA  549

seq1  CGGCACCTTGCCTGATTTTCTTTCTTTTTCG-TTTTTTTTTTTTTTTCAA  597
      ||||||||||||||||||||||||||||||| |||||||||||||||  |
seq2  CGGCACCTTGCCTGATTTTCTTTCTTTTTCGTTTTTTTTTTTTTTTTTCA  599

seq1  GACAGAGTTTTGCTCTGTAGCACAGGATGGCCTCAAAAAATGCAGTATGT  647
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GACAGAGTTTTGCTCTGTAGCACAGGATGGCCTCAAAAAATGCAGAATGT  649

seq1  TTGTTTGTTTAAAACAGGGCTTTCTGTCCTGGAACTCACTGTATAGACCA  697
      | |||||||||||| |||  ||||||||||||||||||||||| ||||||
seq2  TCGTTTGTTTAAAA-AGGTTTTTCTGTCCTGGAACTCACTGTAAAGACCA  698

Information of reverse sequence (DDBJ: AG539005)
Chromosome X position(base) 50217120 - 50217251 strand -
Alignment
seq1: chrX_50217120_50217251
seq2: MSMg01-451I15.TJ_216_433 (reverse)

seq1  CACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACT  50
      |||||||||||||||||||||||||||||||||| |   || |||  |||
seq2  CACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAATGTAAGTACCAGTACT  50

seq1  GCCCGGCTTCATTGGCTTTTCTTAAAACAATTGATTTATTCATT------  94
       ||          | |||||  ||| | | | |||||||  |||      
seq2  TCC---------AGCCTTTTTGTAAGAAACTAGATTTATGTATTATATTC  91

seq1  TAAAAATAT-----TTTTA--ATTG-CAGTG-CTGGGAA---CT-GAACC  131
      ||   || |     |||||   |||  ||||  || | |   || | |||
seq2  TAGGTATGTGAGTGTTTTACGTTTGTGAGTGTATGTGTATGCCTCGTACC  141

seq1  C-------------------------------------------------  132
      |                                                 
seq2  CATGCAGGTCAGTTCTAGGTCTCCTGGGAACTGGAGGCTGATTGTGAGCT  191

seq1  ---------------------------  132
                                 
seq2  ACCAGGTGGGTGCTGGGAACTGAACCC  218