Top
IDMSMg01-442F19
Information of forward sequence (DDBJ: AG532026)
Chromosome X position(base) 50339995 - 50340442 strand -
Alignment
seq1: chrX_50339995_50340442
seq2: MSMg01-442F19.T7_50_501 (reverse)

seq1  GCAATCCTTTAATTCCCCCATATTCCCATCAAGTACGGTTAATATGCTTA  50
      |||||||| |||||||||||| ||| ||||||||| ||| ||||||||||
seq2  GCAATCCTGTAATTCCCCCATGTTCTCATCAAGTATGGTAAATATGCTTA  50

seq1  CTTTATCTATTTATTTGTTTATTCATTCTTTTTTTGTTGTTGTTGTATAA  100
      | ||||||||||| | |||||||||||||||||| |||||||| ||||||
seq2  CGTTATCTATTTAGTGGTTTATTCATTCTTTTTTGGTTGTTGTAGTATAA  100

seq1  GATTGAACCCAGAAGCCGGGCGCGGTGGCACACGCCTTTAATCCCAGCAC  150
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GATTGAACCCAGAAGCCGGGCGTGGTGGCACACGCCTTTAATCCCAGCAC  150

seq1  TCGGGAGGCAGAGGCAGCCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTA  200
      |||||||||||||||||||||||||  |||||||||||||||||||||||
seq2  TCGGGAGGCAGAGGCAGCCGGATTTAAGAGTTCAAGGCCAGCCTGGTCTA  200

seq1  CAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCAA  250
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  CAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGA  250

seq1  AAAAAAACC---AAAAAAAAAAAAAAAAAAGATTGAACCCAGAGCCTCTT  297
      |||||| ||   ||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACCCAAAAAAAAAAAAAAAAAAAAAGATTGAACCCAGAGCCTCTT  300

seq1  AGAGCCCAAATGTACTACTGCTCTGCTCTCTTCCTGGCTCTTTTATTTTT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCCAAATGTACTACTGCTCTGCTCTCTTCCTGGCTCTTTTATTTTT  350

seq1  TCAAACACTAGTCAGTCAGTTTGTTCGTTCGTTGGTTAGTTAGTTAGTTA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAACACTAGTCAGTCAGTTTGTTCGTTCGTTGGTTAGTTAGTTAGTTA  400

seq1  GTTGTTTTTCAG-CCAGGGTCTCACTTTGTAATGCAGGCTCGTCTGGAAT  446
      |||||||||||| ||||||||||||||||||||||||| | |||||||||
seq2  GTTGTTTTTCAGCCCAGGGTCTCACTTTGTAATGCAGGATAGTCTGGAAT  450

seq1  TC  448
      ||
seq2  TC  452

Information of reverse sequence (DDBJ: AG532027)
Mapping result un_mapped
BAC sequence