Top
IDMSMg01-415P16
Information of forward sequence (DDBJ: AG511907)
Mapping result un_mapped
BAC sequence
Information of reverse sequence (DDBJ: AG511908)
Chromosome X position(base) 50150643 - 50151289 strand +
Alignment
seq1: chrX_50150643_50151289
seq2: MSMg01-415P16.TJ_58_704

seq1  AGGAATTCATAGGTCAAGGCAGAAGGGCATTTGGCAGAGTTAGTCATGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAATTCATAGGTCAAGGCAGAAGGGCATTTGGCAGAGTTAGTCATGAG  50

seq1  GAAGTCTGCGCTAAGCTTTACCAGAAGTAGCTCACGTTGCATCAAGCCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTCTGCGCTAAGCTTTACCAGAAGTAGCTCACGTTGCATCAAGCCTT  100

seq1  GAAGTTTCTTTTCGGTCACTTTAAAGAATGAACAAACAGTAGTTCTACCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTTTCTTTTCGGTCACTTTAAAGAATGAACAAACAGTAGTTCTACCT  150

seq1  GAGAAAACTGGCGGGAGGGGGCACGGGGAGCGGGGGGAGAAAGGTCAGAC  200
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  GAGAAAACTGGCGGGAGGGGGCACGGGGAGTGGGGGGAGAAAGGTCAGAC  200

seq1  ATATTCAAGGAAAAGGCATGTTAACAATATTTGCCTAGTAATTCCAAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||    
seq2  ATATTCAAGGAAAAGGCATGTTAACAATATTTGCCTAGTAATTCCATTTT  250

seq1  AACCTTTTTTATTATTTAAAGCACTGTTTTCTGTGCATACAGGTGCCTTC  300
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTTTTTATTATTTAAAGCACTGTTTTCTGTGCATACAGGTGCCTTC  300

seq1  TCACAGGACTGTTATTCTACAAAGAATAACTCTGTGTGTTCACTTACTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGGACTGTTATTCTACAAAGAATAACTCTGTGTGTTCACTTACTGA  350

seq1  TTCTATTTCATGGAATGGAAGAATTTTAGTGGTGCAGGTGTTTGTCGAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTATTTCATGGAATGGAAGAATTTTAGTGGTGCAGGTGTTTGTCGAAT  400

seq1  TTAGCTATGTTAGCCCTTTTCATTTATAAACTAACAGGAGGTGCAAGTTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTATGTTAGCCCTTTTCATTTATAAACTAACAGGAGGTGCAAGTTA  450

seq1  GTTTGAGGAGAACTGGCTTCCACATGTTCAGGCAGTCTCAGGGGGAAGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGAGGAGAACTGGCTTCCACATGTTCAGGCAGTCTCAGGGGGAAGGG  500

seq1  GGGGGGAAATCAATATTCTTAGTTCTTTCGACTACCCATGCATGGGCTAA  550
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGGAATCAATATTCTTAGTTCTTTCGACTACCCATGCATGGGCTAA  550

seq1  CCCATGGAGATAATTAGGCTTGGTTTTAAATTTTGTTTTTCAGGAAATCA  600
      |||||||||||||||||||||||||||||| ||||| |||||||||| ||
seq2  CCCATGGAGATAATTAGGCTTGGTTTTAAACTTTGTCTTTCAGGAAACCA  600

seq1  AACAGGTACCCAGGAAAATGGATGCTCGAAGAAAGCACTGGAAAGAC  647
      |||||||||||||||||||||||||||||| || |||||||||||||
seq2  AACAGGTACCCAGGAAAATGGATGCTCGAACAATGCACTGGAAAGAC  647