Top
IDMSMg01-390M15
Information of forward sequence (DDBJ: AG492716)
Chromosome 4 position(base) 31803413 - 31804074 strand +
Alignment
seq1: chr4_31803413_31804074
seq2: MSMg01-390M15.T7_53_714

seq1  GAATTCTCCAGCCCTTATCCCATAATACCCCACCAAATCTCTACAAAGAA  50
      ||||||||||| | || |||||||||||||||||||||||||||||||||
seq2  GAATTCTCCAGNCTTTCTCCCATAATACCCCACCAAATCTCTACAAAGAA  50

seq1  TTGGTACTTGCTAATGTTCTGCCCCTAGTCTTCTTGATCTGTTTCTTTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTACTTGCTAATGTTCTGCCCCTAGTCTTCTTGATCTGTTTCTTTTC  100

seq1  CCCAGAGACTATACACTTCCAACCACCAACAGTAGGAATCTGAGATGATA  150
      ||  |||||||||||||| |||||||||||||||||||||||||||||||
seq2  CCAGGAGACTATACACTTTCAACCACCAACAGTAGGAATCTGAGATGATA  150

seq1  TCTAAGCACATCCCAGGACCCTGGCTTCTCTTCATAGTCCATACTTTGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAGCACATCCCAGGACCCTGGCTTCTCTTCATAGTCCATACTTTGAT  200

seq1  TCTTAGCTGTCTGCTGTTCACTTCTACTCAGCCTAAATTTACCCCTGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGCTGTCTGCTGTTCACTTCTACTCAGCCTAAATTTACCCCTGAAA  250

seq1  TGGCATCATTAGCTAGTCCATCTTGCTCACTCCACCAATAATCGTTTTAT  300
      |||||| |||||||||||| | |||||||||||||| |||| | ||||||
seq2  TGGCATTATTAGCTAGTCCTTTTTGCTCACTCCACCGATAACCATTTTAT  300

seq1  TAATTATTTTTTATTAAATTTGCTTAGACCATTTTAAACATTTACTCAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTATTTTTTATTAAATTTGCTTAGACCATTTTAAACATTTACTCAAA  350

seq1  GCATTGTGATTACTCTCATCTCCTCCTGTCTTTTGTTGCCTCCCACTTCT  400
      ||||||||||||||||||||||||||| ||||||||  ||||||||||||
seq2  GCATTGTGATTACTCTCATCTCCTCCTCTCTTTTGTCTCCTCCCACTTCT  400

seq1  GTTAGCCTCACTCTGTCTCCCACCCTTCCCACAAGTCTCTTCCCTACTTT  450
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGCCTCGCTCTGTCTCCCACCCTTCCCACAAGTCTCTTCCCTACTTT  450

seq1  TATGTTTTCGTTTGTTTTGTGAATCACTGAGTTTAACCAGGGCTGTCTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTTTTCGTTTGTTTTGTGAATCACTGAGTTTAACCAGGGCTGTCTCT  500

seq1  GTAACCATGGGCTTGGAAATGTTCAATGGAGTTGGCGAACTCAACAGTGC  550
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GTAACCATGGACTTGGAAATGTTCAATGGAGTTGGCGAACTCAACAGTGC  550

seq1  CTTCAGATTCTTCATCTGTCTTCTTCTCTTTCTCTTTGCACACTGGATCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAGATTCTTCATCTGTCTTCTTCTCTTTCTCTTTGCACACTGGATCT  600

seq1  CAAGCCTCAGGTTATCCCTATACCTTTGTTCCTGTGTAAGGTCATCTTTC  650
      || |||||||| |||||||||||||||||||||||| || | | ||||||
seq2  CACGCCTCAGGCTATCCCTATACCTTTGTTCCTGTGGAAAGGCCTCTTTC  650

seq1  TGGAAAGCCTCC  662
      ||||||||||||
seq2  TGGAAAGCCTCC  662

Information of reverse sequence (DDBJ: AG492717)
Chromosome X position(base) 50377553 - 50377758 strand -
Alignment
seq1: chrX_50377553_50377758
seq2: MSMg01-390M15.TJ_112_323 (reverse)

seq1  CTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAAACACATGGTGGCTCAC  50
      ||||||||| |||||||||||||||||||||||| |||||||||||||||
seq2  CTCTTCCAGGGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCAC  50

seq1  AACACTCAGCAA-------------CCAC--GTGGTGGCTCACAACACTG  85
      |||  || | ||             || |   |||||  ||  || ||  
seq2  AACTATCTGTAAAATGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAC--  98

seq1  AGCAACCACATGGTGGCTCATAACACTCAGCAACCACGTGGTGGCTCACA  135
      ||||||   |||    ||| |     |  |       || |||  || | 
seq2  AGCAAC--AATGTAATCTCGTGTGTGTGTGTGTGTGTGT-GTGCGTC-CC  144

seq1  ACCATCTG-GAATGGGATTTGATTCCCTCT-TGTG-GTGTGTCTGAAAAG  182
       || | || |  || | | ||  |   | | |||| |||||| ||     
seq2  CCCGTGTGTGTGTGTG-TGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGT  193

seq1  GGACATAAATAAATCTTTTTTAAA  206
      | ||||     |||||||||||||
seq2  GCACAT-----AATCTTTTTTAAA  212