Top
IDMSMg01-304B21
Information of forward sequence (DDBJ: AG429506)
Chromosome X position(base) 50442371 - 50442951 strand +
Alignment
seq1: chrX_50442371_50442951
seq2: MSMg01-304B21.T7_60_640

seq1  GAATTCTACCTGCTGGTGTCTGTTACAAGTTAATGCCTGCCTTTTAGACG  50
      |||||||||| ||||||||||| ||  || ||||||||||||||||||||
seq2  GAATTCTACCCGCTGGTGTCTGCTA-TAGATAATGCCTGCCTTTTAGACG  49

seq1  TACAAAGAGTTCCGAGAGTGAACCATGGATACAAAGAAGGGTCCTTGCCT  100
      ||||||||||||| | ||||||||||||||||||||||||| ||||||||
seq2  TACAAAGAGTTCCCATAGTGAACCATGGATACAAAGAAGGGCCCTTGCCT  99

seq1  ACTTCCCGAGTCACAGCATGGCTGAGGAAAAGTTGCCACCCAAAGGTGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCCCGAGTCACAGCATGGCTGAGGAAAAGTTGCCACCCAAAGGTGGT  149

seq1  GGTGATTCCATGGATCTCCCAGCTCTCAATGTGATGCTTTGATTGGAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGATTCCATGGATCTCCCAGCTCTCAATGTGATGCTTTGATTGGAATT  199

seq1  CAGTGCAGAGAAAGTCCCGTGAACAGGGCTCTCATTTAAAGTTTAAAATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGCAGAGAAAGTCCCGTGAACAGGGCTCTCATTTAAAGTTTAAAATG  249

seq1  TCCTTTCATAACTGTTGAGAAGGCGGTTTGTATACATAGAGAACATCTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTCATAACTGTTGAGAAGGCGGTTTGTATACATAGAGAACATCTAG  299

seq1  GATTTGCCCGTTTCTGT-GAAAAAAAAAAAACCTTCCTGACTGTAAATCC  349
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  GATTTGCCCGTTTCTGTGGAAAAAAAAAAAACCTTCCTGACTGTAAATCC  349

seq1  TGTGTTCTGTAAATAATTTGTGAGTCCAAGAAGACCAATAACTCGCATTT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTTCTGTAAATAATTTGTGAGTCCAAGAAGACCAATAACTCGCATTT  399

seq1  TCCTATCCCACAGTCCACTGTACTTTTGAAGCCCTCAGCCAGGGGAGGGG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTATCCCACAGTCCACTGTACTTTTGAAGCCCTCAGCCAGGGGAGGGG  449

seq1  GAAAAGGCATCTGTGAGAGAGATGGATCCAAACACACATATTTATTTAGT  499
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GAAAAGGCATCTGTGAGAGAGATGGATCCAAACACACATATTTATTGAGT  499

seq1  AAACAAGCTCATCAACTTCTATATTTTAAAGTTCATTGTGAGCAAATGTA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAGCTCATCAACTTCTATATTTTAAAGTTCATTGTGAGCAAATGTA  549

seq1  AGTGCAGGCTCCATTTTGTGTGGGGTGGGTGG  581
      ||||||||||||||||||||||||||||||||
seq2  AGTGCAGGCTCCATTTTGTGTGGGGTGGGTGG  581

Information of reverse sequence (DDBJ: AG429507)
Chromosome X position(base) 50481173 - 50482125 strand -
Alignment
seq1: chrX_50481173_50482125
seq2: MSMg01-304B21.TJ_84_1040 (reverse)

seq1  TAATTTGTACAGC-TGCTTTTTCGTTTGGTTTCTTCCAAGAAAGAG-AGA  48
      ||||||| ||||| | |||||| |||||||||| |   | |||||| |||
seq2  TAATTTGCACAGCTTTCTTTTTGGTTTGGTTTCCTAACAAAAAGAGAAGA  50

seq1  GGAAATAAGGTTGCCAGCAAATCTGC-AGTTACCAAGGTTTCCCTAAGAT  97
      ||||||||| |  ||||||  || || | || ||||||||||| ||||| 
seq2  GGAAATAAGTTGCCCAGCATTTCGGCAATTTCCCAAGGTTTCCTTAAGAA  100

seq1  GAATATTATTTTTCTCTTCTAATTCCACCAAATACAGTATAAAGAAAAGC  147
      |||||||||||||   ||||| |||| |||||||||||||||||||||||
seq2  GAATATTATTTTTTCTTTCTATTTCCNCCAAATACAGTATAAAGAAAAGC  150

seq1  ATGTGACTATTCCACAAATTTAGTTATGCCAGAGGGTCAAATCCTGTACT  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGACTATTCCACAAATTTAGTTATGCCAGAGGGTCAAATCCTGTACT  200

seq1  CTGTCCACGTCCTGCTGTTGGGAGACATATAATGCTGATTTCCTAACCCA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCACGTCCTGCTGTTGGGAGACATATAATGCTGATTTCCTAACCCA  250

seq1  CTATTTAGGAAAATTGTACTGTAGTTGCAGAATGGTAAATTCCCCTGATT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTAGGAAAATTGTACTGTAGTTGCAGAATGGTAAATTCCCCTGATT  300

seq1  TTGTGCTTAGATTCTCAGACTTGGCTCGTCCTGAGTTTCAGCAGAAATGT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGCTTAGATTCTCAGACTTGGCTCGTCCTGAGTTTCAGCAGAAATGT  350

seq1  GAAAGGCACTGCTTTGGAGAGGCTAGGGAAATGGGAGAAGTCAGGCAGGA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGCACTGCTTTGGAGAGGCTAGGGAAATGGGAGAAGTCAGGCAGGA  400

seq1  GAAATCTCAAGGAGTAGGTATTTGGAGCATCAGATTCTGTTTTATGCTCT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATCTCAAGGAGTAGGTATTTGGAGCATCAGATTCTGTTTTATGCTCT  450

seq1  GCCACTGACATGCTCTGTGACACAGTCAAGTTACTTCTTACGAAACATTT  497
      ||||||||||||||||||| |||||||||||||||||||||||||||  |
seq2  GCCACTGACATGCTCTGTGGCACAGTCAAGTTACTTCTTACGAAACACCT  500

seq1  TCCAGGGGGATCAGAGTGGCATATGCTCAAAGGCTCTTTCCAATCAAAAA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGGGGATCAGAGTGGCATATGCTCAAAGGCTCTTTCCAATCAAAAA  550

seq1  TTATTGGACCCTGTAAATTAGGGTTTGGGGTTTCTATAAAGGCTAGTCAA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTGGACCCTGTAAATTAGGGTTTGGGGTTTCTATAAAGGCTAGTCAA  600

seq1  GCTAGGTGTAGTAACACATGCTTATAATCTCAGCACTAGGGAGGCAGGGA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGGTGTAGTAACACATGCTTATAATCTCAGCACTAGGGAGGCAGGGA  650

seq1  CAGGAGGATCACAAGGTTGAAGCCAGCTTAGACTTTTAGTGAGACTCTGT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGGATCACAAGGTTGAAGCCAGCTTAGACTTTTAGTGAGACTCTGT  700

seq1  CTTTAAATAGAAATTT-AAAGCCAATAAGAAAAGTCCCAAAGGTTTGTGG  746
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  CTTTAAATAGAAATTTAAAAGCCAATAAGAAAAGTCCCAAAGGTTTGTGG  750

seq1  GTATTAACAAGGCTTTCTTCCACTGATCTATCCTTATGAGACATTTGTCC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATTAACAAGGCTTTCTTCCACTGATCTATCCTTATGAGACATTTGTCC  800

seq1  AAGTTCTTGGTTCTCATTTTTATAGTCTGAGAAGAACTGTCTAAAGAGAC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCTTGGTTCTCATTTTTATAGTCTGAGAAGAACTGTCTAAAGAGAC  850

seq1  TGTTCATGTTCTTACTGAAGTAGTAGCTGGTATGAGAGGCCAGTTTTTTA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCATGTTCTTACTGAAGTAGTAGCTGGTATGAGAGGCCAGTTTTTTA  900

seq1  AAGCTTCATTGGGATATATGTTACACACCATGCAATCAATGTACCCTTTT  946
      |||||| ||||||||||||| |||||||||||||||| ||||||||||||
seq2  AAGCTTTATTGGGATATATGGTACACACCATGCAATCGATGTACCCTTTT  950

seq1  AAAGTAT  953
      |||||||
seq2  AAAGTAT  957