Top
IDMSMg01-271C06
Information of forward sequence (DDBJ: AG410776)
Chromosome X position(base) 50530204 - 50530897 strand -
Alignment
seq1: chrX_50530204_50530897
seq2: MSMg01-271C06.T7_52_746 (reverse)

seq1  CCCCATTGTCCAGGCCAAGAAAACCTTGAGTCGGAGTCATCTCAAACTCC  50
      ||||||| |||||||||||||| |||||||||||||||||||||||||||
seq2  CCCCATTATCCAGGCCAAGAAACCCTTGAGTCGGAGTCATCTCAAACTCC  50

seq1  TCGTCTTCTTTCGCTCACCCATTTCACAGACAGCATAGTGCCCAGTGCAG  100
      |||| |||||||||||||||| ||||||||||||||||||| ||||||||
seq2  TCGTTTTCTTTCGCTCACCCACTTCACAGACAGCATAGTGCACAGTGCAG  100

seq1  AGCTGACTCAGAAACATCACATTGACTAATAAACTGAGAATGTCTAGAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGACTCAGAAACATCACATTGACTAATAAACTGAGAATGTCTAGAAA  150

seq1  TAAAGGGAAAACTAGACTTTAAATAAGCTTCTTATTTGGGGTTGATTTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGGAAAACTAGACTTTAAATAAGCTTCTTATTTGGGGTTGATTTGT  200

seq1  TTGTTTCAGAACGTCCTCTGTAAAAAGTAGGGACGATGATAGACGATAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTCAGAACGTCCTCTGTAAAAAGTAGGGACGATGATAGACGATAAC  250

seq1  CTAGTTCATGTGAATCGCTGTGGCTTAAATCAGACATATGCAGAAAAGGA  300
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  CTAGTTCATGTGAATTGCTGTGGCTTAAATCAGACATATGCAGAAAAGGA  300

seq1  ATGGCCGTGTGTGTGCAAACGTGCTTTACACTGCCTAAGCATGAGGCCAA  350
      |||||||||||||| |     | |||| |  |||||||||||||||||||
seq2  ATGGCCGTGTGTGTTCTTTTTTTCTTTGCGGTGCCTAAGCATGAGGCCAA  350

seq1  GAGCGGGGGAAGACTGACGAGAAGTTTCAAACC-TAATTCCTGCTCTCCC  399
      |||||||||||| | | || | ||  |||||||  ||| |||||||||||
seq2  GAGCGGGGGAAGNCGGGCGGGGAGGGTCAAACCAAAATACCTGCTCTCCC  400

seq1  AAAGCTCAGGATCTGCCTGGGGAAAGCTAATGAATCCAGATGGAGCAATC  449
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  AAAGCTCAGGATCTGCCTGGGGAAAGATAATGAATCCAGATGGAGCAATC  450

seq1  AAGGAGCAAAGACTTCCCTGGGCAGATGGTCAATCCAGGTGCATGCACTC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGCAAAGACTTCCCTGGGCAGATGGTCAATCCAGGTGCATGCACTC  500

seq1  TGGGCAGGCTGCAGGGCTAAGACTTGAAAATAGGATCTGAAGAGAGAAAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGGCTGCAGGGCTAAGACTTGAAAATAGGATCTGAAGAGAGAAAA  550

seq1  AGAGGAGAAGCGGAACCTTCCAAGGGAAAAAGAACAGCATCAGACATGGC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGAGAAGCGGAACCTTCCAAGGGAAAAAGAACAGCATCAGACATGGC  600

seq1  TGAGGCAGTTACCCGCATGGGATATTTCAGCTGGCCCACTGAGATTTGTC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCAGTTACCCGCATGGGATATTTCAGCTGGCCCACTGAGATTTGTC  650

seq1  CCATCAGCTGCAAGAGAACTCTGGGAAATTGCCTGGTTAGAATTC  694
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCAGCTGCAAGAGAACTCTGGGAAATTGCCTGGTTAGAATTC  695

Information of reverse sequence (DDBJ: AG410777)
Chromosome X position(base) 50378099 - 50378629 strand +
Alignment
seq1: chrX_50378099_50378629
seq2: MSMg01-271C06.TJ_81_611

seq1  TTCTTTTTTTTTCCGCCCCCACCCCCACCCACCTCTATCCCTTGAACTGA  50
      |||||| ||||| | |||||||||||||||||||||||||||||||||||
seq2  TTCTTTCTTTTT-CTCCCCCACCCCCACCCACCTCTATCCCTTGAACTGA  49

seq1  ATTCTGTTGCTGAATGTCTTTGTGCTTTTGATCCTCCTGCCTCCACCTCC  100
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  ATTCTGTTGCTGAATGTCTTTGTGCTTTTGATCCTCCTGCCTCCATCTCC  99

seq1  CAAATTTTGGAATTTAACCCAGTTTATGTAGTGTTAGAGGTTGTACCGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATTTTGGAATTTAACCCAGTTTATGTAGTGTTAGAGGTTGTACCGAG  149

seq1  GGCTTTGTGCATGTTAGACAGTCTACTTCCTGAGCTATATTACCAACCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTGTGCATGTTAGACAGTCTACTTCCTGAGCTATATTACCAACCCC  199

seq1  CTGACGATGTCATTTTTAAAAACCAACTTTCCACAAATCAAATATAGTCG  250
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  CTGACGATGTCATTTTTAAAAACCAACTTTCCACAAATCATATATAGTCG  249

seq1  GTATGTAAGACAGGGAAAGGGAGTCACTGAGAGGTAGCAGTCATTTTC--  298
      ||||||||||||||||||||||||||||||          |  |||||  
seq2  GTATGTAAGACAGGGAAAGGGAGTCACTGA----------TTTTTTTCCC  289

seq1  --------AGGGTAACAGGAGGGGTAAAATCTGAAAGGAAGCTGTACTTT  340
                |||||||||||| ||||||||||||||||| ||| |||||
seq2  CCCCCCCTCCGGTAACAGGAGGAGTAAAATCTGAAAGGAACCTGCACTTT  339

seq1  GCTGTGGCTGTTCAGTATAGGAGCAAAATGCCTACAACTACCCCACCTCA  390
      ||||||  ||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTGAATGTTCAGTATAGGAGCAAAATGCCTACAACTACCCCACCTCA  389

seq1  GTCCTCCAGGACTTCATTTTCATTACAGTCCTGCAAAATGGATGCTGAGA  440
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GTCCTCCAGGACTTCATTTTTATTACAGTCCTGCAAAATGGATGCTGAGA  439

seq1  AAGAAAACAAAATTGCGTTAAAGTTGTTAGAAGTTGTTAGAGACATAGGA  490
      ||||||||||||||||| |||||||| |||||||||||||||| | |  |
seq2  AAGAAAACAAAATTGCGCTAAAGTTGCTAGAAGTTGTTAGAGAGACATTA  489

seq1  AAGCATATATCCATTTTAGGAATTA-TAACTGGAGGGTTTTT  531
      ||||| |||| | |||||||||||| ||||||||||| ||||
seq2  AAGCACATATTCTTTTTAGGAATTATTAACTGGAGGGCTTTT  531