Top
IDMSMg01-205E21
Information of forward sequence (DDBJ: AG389340)
Chromosome X position(base) 50214478 - 50215154 strand -
Alignment
seq1: chrX_50214478_50215154
seq2: MSMg01-205E21.T7_50_726 (reverse)

seq1  CGAGAAAGCCTTTTTAAAGAAATAATGAGACAGTAGCTGTCATCAGTGCG  50
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CGAGAAAG-CTTTTTAAAGAAATAATGAGACAGTAGCTGTCATCAGTGCG  49

seq1  ATGACTGACCAGAAGTGTCTGTGGCATTTCTCTCCCTAAAAGAGAAGCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACTGACCAGAAGTGTCTGTGGCATTTCTCTCCCTAAAAGAGAAGCAG  99

seq1  AACAATGAAATGTAATTGCTAGTTCACAGGAGTTTTTAAGGGGAAGTACT  150
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  AACAATGAAATGTAATTGCTAGTTCACAGGAGTTTNTAAGGGGAAGTACT  149

seq1  GGAGGGAGATGCTACAGAGCATGAAGGCCCTGTAAAGAAAAGAACAAAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGAGATGCTACAGAGCATGAAGGCCCTGTAAAGAAAAGAACAAAAT  199

seq1  ACACAGCATCTACCATCACCCCAGATAAATTCAATCCTGAACCAAGAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGCATCTACCATCACCCCAGATAAATTCAATCCTGAACCAAGAGGG  249

seq1  ACATCACATGGCTGAGGATGGATAGACAGGGAGCTCCAGCATTCCCACTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCACATGGCTGAGGATGGATAGACAGGGAGCTCCAGCATTCCCACTA  299

seq1  AACCTGAAAGCTACCAAAGAAGCCTGCAGCTATCACTGTGGCTGACCAC-  349
      |   ||  ||||||||||||||||||||||||||||||||||||  | | 
seq2  AGGGTGGGAGCTACCAAAGAAGCCTGCAGCTATCACTGTGGCTGGGCGCG  349

seq1  AGTTTAGGAAGTTTCAGACAAATCCAAGCTATTGCTTGCAATTTGTTCTG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTAGGAAGTTTCAGACAAATCCAAGCTATTGCTTGCAATTTGTTCTG  399

seq1  CTCTTCGCTGCAGTCCCTCTGTAGATGTACCCGAGGGTGAGATAGCTGGA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCGCTGCAGTCCCTCTGTAGATGTACCCGAGGGTGAGATAGCTGGA  449

seq1  TCACATGTGAGTACTAATTAAAATGTTTTTGTGTGTTGTATCTAGATCAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACATGTGAGTACTAATTAAAATGTTTTTGTGTGTTGTATCTAGATCAT  499

seq1  TTTTAGAAATGCTGTACCATTATGTGTGCCTACTTGCAATGTGCAGAGAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAGAAATGCTGTACCATTATGTGTGCCTACTTGCAATGTGCAGAGAA  549

seq1  ATCTGAATATTCACTGTTTTCTGTTTGTTTGTTTTTTTAAATCACAGCCA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGAATATTCACTGTTTTCTGTTTGTTTGTTTTTTTAAATCACAGCCA  599

seq1  TCCTAATAGATTTTTAAAATTTATTTGTATGTGTCTTTGTGCATGTGTAT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTAATAGATTTTTAAAATTTATTTGTATGTGTCTTTGTGCATGTGTAT  649

seq1  ATGGTGGGGGGCATACACCTGTGAATTC  677
      ||||||||||||||||||||||||||||
seq2  ATGGTGGGGGGCATACACCTGTGAATTC  677

Information of reverse sequence (DDBJ: AG389341)
Chromosome X position(base) 50160816 - 50161474 strand +
Alignment
seq1: chrX_50160816_50161474
seq2: MSMg01-205E21.TJ_72_730

seq1  GAATTCACATATTTTTCTTTTTTGACTTACTGGTTATTTTTCAGTTACAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACATATTTTTCTTTTTTGACTTACTGGTTATTTTTCAGTTACAA  50

seq1  AAAAGGAAATCCTATCTTGTTCCTTCTTTAACATTTTTATGATTTTATTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGAAATCCTATCTTGTTCCTTCTTTAACATTTTTATGATTTTATTT  100

seq1  TATTTTCAGTTATGTGTATGTGTGTGCATGGTTTGGGTATATGCATGTGA  150
      ||||| ||||||||||||||||||||||||||||| ||||||||||||||
seq2  TATTTGCAGTTATGTGTATGTGTGTGCATGGTTTGAGTATATGCATGTGA  150

seq1  ACATTGGTACTCAAAGATGCAAGAAAAGGGCATTGGATCCCCTGGACCTG  200
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  ACATTGGTACTCAAAAATGCAAGAAAAGGGCATTGGATCCCCTGGACCTG  200

seq1  GACTTGCAATCTGTCATGAGTTAAACGGCAGGGGTCCTGGGAACAGAAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTGCAATCTGTCATGAGTTAAACGGCAGGGGTCCTGGGAACAGAAGT  250

seq1  GAGATCATTTGCAGGAACAGCAAGCATGCAATATCATTGCGCTGTCTCTG  300
      ||||||||||||||||||||||||||||||| |||||||| |||||||||
seq2  GAGATCATTTGCAGGAACAGCAAGCATGCAAAATCATTGCACTGTCTCTG  300

seq1  CCGCCTCAGAAGTGATTCTTGAAAAAGATCTTTTTATTAAAACAACTTCA  350
       |||||||  |   ||||||||||||||||||||||||||||||||||||
seq2  TCGCCTCACCACCCATTCTTGAAAAAGATCTTTTTATTAAAACAACTTCA  350

seq1  ATTACCTCACATGATGTTTTCTTTCAAATCTACAAACGTATTTGAGATTT  400
         |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACCTCACATGATGTTTTCTTTCAAATCTACAAACGTATTTGAGATTT  400

seq1  ACAAAAGCAACATCTCTCCGTCACATATTGAAGTAGACCAAAATCTGGAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAGCAACATCTCTCCGTCACATATTGAAGTAGACCAAAATCTGGAG  450

seq1  AGTTGCTTTTGACATTTATAAATGTGAGTTATGTCAGCAGAGAGCCTGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGCTTTTGACATTTATAAATGTGAGTTATGTCAGCAGAGAGCCTGAA  500

seq1  GGGCATTTCTGGCTCTGAGATTGTCAACTTTCAAAATATGTGCTATACTT  550
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  GGGCATTTCTGACTCTGAGATTGTCAACTTTCAAAATATGTGCTATACTT  550

seq1  TTATGTGGTTGTAATGAATACAAAACTATATCTGCATGAAGCATAAGGAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTGGTTGTAATGAATACAAAACTATATCTGCATGAAGCATAAGGAC  600

seq1  TTTCCCCACCATAAACATGGGTTATCTTAAAACATTTCCTTTGGTTATAT  650
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TTTCCCCACCATAAACATGGGTTATCTTANAACATTTCCTTTGGTTATAT  650

seq1  ATTAAAACA  659
      |||||||||
seq2  ATTAAAACA  659