Top
IDMSMg01-160H13
Information of forward sequence (DDBJ: AG360135)
Chromosome X position(base) 50224093 - 50224606 strand -
Alignment
seq1: chrX_50224093_50224606
seq2: MSMg01-160H13.T7_54_567 (reverse)

seq1  CAAAATTCTCACTACACAGACCAATCTTTGGTTCAAGGTTAATCTGGGCT  50
      |||||||||| |||||||||||||||||| ||||||||||||||||||||
seq2  CAAAATTCTCGCTACACAGACCAATCTTTAGTTCAAGGTTAATCTGGGCT  50

seq1  ACATCAGACCAGCACCACAAGAATCTAAAGAAGTTTATTATCTCTGAATC  100
      ||||||| |||||||||||||||||| |||||||||||||||||| ||||
seq2  ACATCAGGCCAGCACCACAAGAATCTGAAGAAGTTTATTATCTCTTAATC  100

seq1  TCTTTTTTAAAAGAAAGTTCCATTCAGGTGCTGGAGAGAGGGCTCAGCAG  150
      |||||| ||||||||||||||||||||||||||||||||||| |  ||||
seq2  TCTTTTATAAAAGAAAGTTCCATTCAGGTGCTGGAGAGAGGGGTGGGCAG  150

seq1  CTAAGAGCAGTTGTTGCCCTTGCAGAACTAATGTTCCAATGTCCCCAGCT  200
      |||||||||||||||||||||||||||||||||       |    ||   
seq2  CTAAGAGCAGTTGTTGCCCTTGCAGAACTAATGGGGGGGGGGGGACAAAA  200

seq1  CTAGAAGACTCAGTGCCTATGCTTACTGCTTGCATATGATACACATACAT  250
        ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAGACTCAGTGCCTATGCTTACTGCTTGCATATGATACACATACAT  250

seq1  ACACACAGGCCAAATATTCATGCACGCAGAATAACGTTTTGTTTTTTTAA  300
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACGCAGGCCAAATATTCATGCACGCAGAATAACGTTTTGTTTTTTTAA  300

seq1  TTAAAACGAGAGTATATGATATCCCTTGGCACTGGCGTTACAGGCAACTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAACGAGAGTATATGATATCCCTTGGCACTGGCGTTACAGGCAACTG  350

seq1  TGAGCCACCGAATATGGCTGTTGGGCACTGAACTCAGATCCTCTGCAAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCCACCGAATATGGCTGTTGGGCACTGAACTCAGATCCTCTGCAAGA  400

seq1  GTAACTAACTCTTTTAACCATGAATTATAAAACCACGTGTTTTGCCTCTC  450
      ||||| ||||||||||||||||||||||||||||| ||||||||||||||
seq2  GTAACCAACTCTTTTAACCATGAATTATAAAACCATGTGTTTTGCCTCTC  450

seq1  TGTGCTTCACGCTGTATTTCAAATGACAAAAAGCCGTCTTGTGTCATTTG  500
      |||||||||||||||||||||||||||||||||| ||| |||||||||||
seq2  TGTGCTTCACGCTGTATTTCAAATGACAAAAAGCGGTCCTGTGTCATTTG  500

seq1  GTAAGTCAGAATTC  514
      ||||||||||||||
seq2  GTAAGTCAGAATTC  514

Information of reverse sequence (DDBJ: AG360136)
Chromosome X position(base) 50101325 - 50102045 strand +
Alignment
seq1: chrX_50101325_50102045
seq2: MSMg01-160H13.TJ_67_712

seq1  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAACAATTTGTATAGGAAAA  50
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAGCAATTTGTATAGGAAAA  50

seq1  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100

seq1  CTA-TTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACT  149
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACT  150

seq1  GTTAACTAAATAATATCAGTGTGAATTTGATATTAAAGATTTATCCTTTG  199
      |||||                                             
seq2  GTTAA---------------------------------------------  155

seq1  ATGAGGAAAAGAAAGCCTCACTGTATACAATTTGATAGCAAAACGCTGAA  249
                      |||||||||||||||||||||||           
seq2  ----------------CTCACTGTATACAATTTGATAGC-----------  178

seq1  AGCTAAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACG  299
          ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ----AAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACG  224

seq1  TGACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATAC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATAC  274

seq1  CTGTTATTAATTTTCTTGTAAACAAACTTTTCTTTTTTAAAGTGGTTTTT  399
      |||||||||||||||||||||||||||||| | |||||||||||||||||
seq2  CTGTTATTAATTTTCTTGTAAACAAACTTTCCCTTTTTAAAGTGGTTTTT  324

seq1  GTCAACATTTGATTTTTTAAAGTGTGTCTTACATTCTTACATTATTTACA  449
      |||||||||||||||||||||    | |||||||||||||||||||||||
seq2  GTCAACATTTGATTTTTTAAACCCCGCCTTACATTCTTACATTATTTACA  374

seq1  AACATTTCTTATTTTTATTACTATGTGAATTTTGTTTTCAATTACAAAAA  499
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AACATTTCTTATTTTTATTACTATGCGAATTTTGTTTTCAATTACAAAAA  424

seq1  TATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGT  474

seq1  TGGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCC  524

seq1  AATTACATTATCTGTGGATCATTTTTTTTCTCTCTCAGCAAGCAGAAGTC  649
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AATTACATTATCTGTGGATCATTTTTTTTCTCTCTCAGCAAGCAGAAGAC  574

seq1  ATAAACAAGTTTCCTGGGACAAACAACTGTATTTTTACAACTTTAATATT  699
      | |||||||||||||| |||||||||||||||||||||||||||||||||
seq2  AAAAACAAGTTTCCTGTGACAAACAACTGTATTTTTACAACTTTAATATT  624

seq1  TTAAGTCAAAGTGGATAGGCAA  721
      |||||||| ||||||||||| |
seq2  TTAAGTCATAGTGGATAGGCCA  646