Top
IDMSMg01-102G14
Information of forward sequence (DDBJ: AG317564)
Chromosome X position(base) 50484338 - 50484702 strand -
Alignment
seq1: chrX_50484338_50484702
seq2: MSMg01-102G14.T7_48_413 (reverse)

seq1  CCAAAGAAAGCCACCTGGTGGTTTAACTCATGCCTATAATCCCAAACTCA  50
      |||||||||| || ||||||||||||||||||| | ||||  ||  ||||
seq2  CCAAAGAAAGACAACTGGTGGTTTAACTCATGCGTGTAATGGCAGGCTCA  50

seq1  AGAGGCTGAGCTAAAAGGATTGCCATGATTCAGTAGCATCCTGGATTGAA  100
      ||||||||| ||||||||||||||||| |||||||||||     ||||||
seq2  AGAGGCTGACCTAAAAGGATTGCCATGGTTCAGTAGCATAAAAAATTGAA  100

seq1  GGATAGCCTGGGCTATAGAGAGTCTATGTTTAAAAACAAATAAACAAC-A  149
      ||||||||||||||||||||||| | || ||||||||||||||||||| |
seq2  GGATAGCCTGGGCTATAGAGAGTGTGTGGTTAAAAACAAATAAACAACAA  150

seq1  AAAACAGTAAACAAACAAATAAACCCCCAAACCAAACCTCAGACCTTCAG  199
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AAAACAGTAAACAAGCAAATAAACCCCCAAACCAAACCTCAGACCTTCAG  200

seq1  ATTGTGATGGGAACTTCTTTGTTGTAACTGCATACCAGCTCATGACTGGG  249
      |||||||||||||||| ||||| ||||||||||| |||||||||||||| 
seq2  ATTGTGATGGGAACTTGTTTGTAGTAACTGCATAACAGCTCATGACTGGA  250

seq1  GCATTGGCTCTGCCTGCCAATTTCCATCAGAAGTCCTACTTTGGATGTCA  299
       ||||||||||||||||||||||||||| ||||||||||| |||||||||
seq2  ACATTGGCTCTGCCTGCCAATTTCCATCGGAAGTCCTACTGTGGATGTCA  300

seq1  AATTCCATGTTAGGTACTTAGAGATACAATTATGAATTAGACATGGTTGC  349
      |||||||||||||||||| |||||||||||||||||| ||||||||||| 
seq2  AATTCCATGTTAGGTACTGAGAGATACAATTATGAATGAGACATGGTTGG  350

seq1  TGCCCTTAAGGAATTC  365
       | |||||||||||||
seq2  AGACCTTAAGGAATTC  366

Information of reverse sequence (DDBJ: AG317565)
Mapping result un_mapped
BAC sequence