Top
IDMSMg01-097C06
Information of forward sequence (DDBJ: AG313648)
Mapping result un_mapped
BAC sequence
Information of reverse sequence (DDBJ: AG313649)
Chromosome X position(base) 50402718 - 50403097 strand -
Alignment
seq1: chrX_50402718_50403097
seq2: MSMg01-097C06.TJ_147_529 (reverse)

seq1  AGCGAGTAGCATTTCACAATGGG-ACACAAATCAAAGCACAACAAAACAA  49
      |||||||||| |||||| |||||    |   ||||||  || ||||||||
seq2  AGCGAGTAGCCTTTCACCATGGGTGTGCTTGTCAAAGTCCAGCAAAACAA  50

seq1  AGAAACAGCAAAACTGTGAAGATGGGGAAAAA-AAAACAAAACAAATAAG  98
      |                   |||||||||||| |   |    | ||||||
seq2  ANNNNNNNNNNNNNNNNNNTGATGGGGAAAAAGAGGGCGGGGCGAATAAG  100

seq1  CAGCTAACCAACCTACTACAAATTCTGTTTTTAAAAAGTCTCTTTGTTTT  148
      |||||||||||| | |||||||||||||||||||||| | | ||||||||
seq2  CAGCTAACCAACATCCTACAAATTCTGTTTTTAAAAAATATATTTGTTTT  150

seq1  GCAGTTTCTTTCCAGTTT-CTACTCTACTTTCAGCCACCAGAGTTAGTGT  197
      ||||  |||  |||||||  |||| |||||||||||||| | ||||||||
seq2  GCAGCCTCTAGCCAGTTTGGTACTTTACTTTCAGCCACCGGGGTTAGTGT  200

seq1  AATTCTGTGGCCTTGATTTTTAAAAGCTTGTTATCTTAAGAATGTTTCTA  247
      ||||| |||||||||||||||||||||| ||||| ||||||||||||| |
seq2  AATTCGGTGGCCTTGATTTTTAAAAGCTGGTTATGTTAAGAATGTTTCCA  250

seq1  AGTTTCTAGGTAGTTTTTATGATTATTCACAATGACTAAAAACGTTCTTT  297
      ||||| ||||||||||||||||||  ||||||||||||||||||||||||
seq2  AGTTTATAGGTAGTTTTTATGATTCCTCACAATGACTAAAAACGTTCTTT  300

seq1  TGAGGATGCCACTAAATTAATCTCTATGGTTAGTTCATATTTGCTCCCTT  347
      ||||||||||||||||||||||| ||||||||| |||||| |||||||||
seq2  TGAGGATGCCACTAAATTAATCTATATGGTTAGGTCATATGTGCTCCCTT  350

seq1  AATTTACTTGAGTCTATAGAAAGGATCAAAGCT  380
      || ||||||||||||||||||||| ||||||||
seq2  AACTTACTTGAGTCTATAGAAAGGCTCAAAGCT  383