Top
IDMSMg01-097A10
Information of forward sequence (DDBJ: AG313562)
Chromosome X position(base) 50238473 - 50239591 strand +
Alignment
seq1: chrX_50238473_50239591
seq2: MSMg01-097A10.T7_198_441

seq1  CTCCTATCTCAAGTCTCCAATCTTGCTCTATTACTGCAAGTCTCTAGGAA  50
                                                        
seq2  --------------------------------------------------  0

seq1  GTCTACTAGCTCAGACTTCCATTTTTCTATCCCTGCAAGTTGCTACGAAG  100
                                                        
seq2  --------------------------------------------------  0

seq1  CTCTGATTCAAGTCATTCATTTTGCTCTATCCCTGCAAGCCTCTAGGAAG  150
                                                        
seq2  --------------------------------------------------  0

seq1  TCTCCTTTCTCATTCTCCCATCTTGAGATATCCCAGCAAGCATAAAAGAA  200
                                                        
seq2  --------------------------------------------------  0

seq1  GTCTACTATCTCAAGTCTCCCATCTTGCTCTATTACTGCAAGCCTCTAGG  250
        || |||||||||| ||| |||||||||||||  |||||| ||||||||
seq2  --CTCCTATCTCAAGGCTCTCATCTTGCTCTATCCCTGCAATCCTCTAGG  48

seq1  AAGTCTACTATCTAAGACTCCCAGTTGCTCTATCCCTGCAAGTATGCCTG  300
      || ||| |||||| || ||| |       || | |||||    || ||||
seq2  AACTCTCCTATCTCAGTCTCAC-------CTTTGCCTGC----ATCCCTG  87

seq1  CAAGCCTCTAGGAAGTCTCCTATCTCTTTATTCCATCTTGCTCTATCCTG  350
      ||||||||||||||||||| ||||||    |  | || ||||||||||  
seq2  CAAGCCTCTAGGAAGTCTCTTATCTCAGACTCTCTTCGTGCTCTATCCCT  137

seq1  GAAAGCCTCTAGAAAGCATTCTATCTCAAGTCTCCCATCGTGTTCTATTC  400
      | ||||||  |  || | | ||| ||||  |||  |||| || |||| ||
seq2  GCAAGCCTGCACGAACCCTCCTACCTCATTTCTTTCATCCTGCTCTA-TC  186

seq1  CTGCAAGCCTCTAGGAAGCCTCCTATCTCAGACTCCCATCGTGCTCTATC  450
      ||||||||||   ||||  ||||||| |||  |||||| | |||||||||
seq2  CTGCAAGCCTACCGGAACTCTCCTATATCATTCTCCCACCTTGCTCTATC  236

seq1  CCTGCAAGCCTCTAGGAAGCTTCCTATCTCACATCTCTCAACTTGCTCTA  500
      |||| |||                                          
seq2  CCTG-AAGA-----------------------------------------  244

seq1  CCCCTACAAGCCGCTAAGAAGGTTCCTATCTCAGCTCCCCTCTTGCTCTA  550
                                                        
seq2  --------------------------------------------------  244

seq1  TCCCTGCAAGCCTAAAGGAAGACTCCTATCTCATTCTCCTATCCCAAGTC  600
                                                        
seq2  --------------------------------------------------  244

seq1  TCCCTAAAAGCCTCTAGGAAGTCTCCTATCTCAGAATCCCATCTTGCTCT  650
                                                        
seq2  --------------------------------------------------  244

seq1  ATCACTGCAGGCCTCTAGAAATCCTCCTATCTCAGACTTACACCTTGCAA  700
                                                        
seq2  --------------------------------------------------  244

seq1  TATCACTACAGGCCTCTAGGAACCTCCTATCTCAAGTCTCCCATATTAAT  750
                                                        
seq2  --------------------------------------------------  244

seq1  CTATCCTTGCAAGTGTCTATGAAGTCTCCTATATCATTAATCCATCTTGC  800
                                                        
seq2  --------------------------------------------------  244

seq1  TCTATCCGTTCAAACCTCTAGGATGTCTCCCATCTCATTCTCCCATCTTC  850
                                                        
seq2  --------------------------------------------------  244

seq1  CTCTATCACTTCAAGCCTCTAGAAAGCCTCCTATCTCAAGGCTCCCACCT  900
                                                        
seq2  --------------------------------------------------  244

seq1  TGCTCTATTCCTGCAAGCCTCTAGGAAGACTCCTATCTCATTCTCCCATC  950
                                                        
seq2  --------------------------------------------------  244

seq1  TCTCTCCTTGCAAGCCTCTATGAAGCCTCCTATCTCATTTTCCCATCTTG  1000
                                                        
seq2  --------------------------------------------------  244

seq1  CTCTACCCCTGCAAGCCTCTATAAAGACTCCTATCCGAAGTCTCCCATCA  1050
                                                        
seq2  --------------------------------------------------  244

seq1  TGCTCTATCCCTACAGGCCTTTAGGAATCCTCATATCTCAAGTATCTCTT  1100
                                                        
seq2  --------------------------------------------------  244

seq1  CTTGCTCTATCCCTGAAGA  1119
                         
seq2  -------------------  244

Information of reverse sequence (DDBJ: AG313563)
Chromosome X position(base) 50402597 - 50403110 strand -
Alignment
seq1: chrX_50402597_50403110
seq2: MSMg01-097A10.TJ_130_650 (reverse)

seq1  GTTATCAATCTG-TCACAAGGGCAC-AGTGGTATCTC-GTGACATGATGA  47
      ||||||| ||||  ||||||||||| | ||||||||| | | ||||||||
seq2  GTTATCAGTCTGAACACAAGGGCACAAATGGTATCTCGGGGGCATGATGA  50

seq1  TCCCCG--AGACGTCTGAGATCC-CTGCATGTGTAACCTCAAATTTCTGG  94
      ||||||   | |||| ||||||| ||||  | |||||||||||||| |||
seq2  TCCCCGGAGGCCGTCGGAGATCCGCTGCGGGAGTAACCTCAAATTTATGG  100

seq1  ATCTCCCA-GTACCCTTAAAGACCTTTTAGCGAGTAGCATTTCACAATGG  143
      |||||||| |    ||||||| ||||||| ||||||||  ||||||| ||
seq2  ATCTCCCAGGGGGACTTAAAGGCCTTTTAACGAGTAGCGGTTCACAAAGG  150

seq1  GACACAAATCAAAGCACAACAAAACAAAGAAACAGCAAAACTGTGAAGAT  193
       |||| ||||||| |||||| |  ||||                  ||||
seq2  AACACGAATCAAATCACAACGAGGCAAANNNNNNNNNNNNNNNNNNAGAT  200

seq1  GGGGAAAAAAAAACAAAACAAATAAGCAGCTAACCAACCTACTACAAATT  243
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  GGGGAAAAAAAAGCAAAACAAATAAGCAGCTAACCAACCTACTACAAATT  250

seq1  CTGTTTTTAAAAAGTCTCTTTGTTTTGCAGTTTCTTTCCAGTTTCTACTC  293
      ||||||||||||||| |||||||||||||||||||||||||||| |||||
seq2  CTGTTTTTAAAAAGTATCTTTGTTTTGCAGTTTCTTTCCAGTTTATACTC  300

seq1  TACTTTCAGCCACCAGAGTTAGTGTAATTCTGTGGCCTTGATTTTTAAAA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTTCAGCCACCAGAGTTAGTGTAATTCTGTGGCCTTGATTTTTAAAA  350

seq1  GCTTGTTATCTTAAGAATGTTTCTAAGTTTCTAGGTAGTTTTTATGATTA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGTTATCTTAAGAATGTTTCTAAGTTTCTAGGTAGTTTTTATGATTA  400

seq1  TTCACAATGACTAAAAACGTTCTTTTGAGGATGCCACTAAATTAATCTCT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACAATGACTAAAAACGTTCTTTTGAGGATGCCACTAAATTAATCTCT  450

seq1  ATGGTTAGTTCATATTTGCTCCCTTAATTTACTTGAGTCTATAGAAAGGA  493
      |||||||||||||  |||||||||||||||||||||||||||||||||||
seq2  ATGGTTAGTTCATGGTTGCTCCCTTAATTTACTTGAGTCTATAGAAAGGA  500

seq1  TCAAAGCTTTAAAGTGAATTC  514
      |||||||||||||||| ||||
seq2  TCAAAGCTTTAAAGTGTATTC  521