Top
IDMSMg01-094K09
Information of forward sequence (DDBJ: AG311758)
Mapping result un_mapped
BAC sequence
Information of reverse sequence (DDBJ: AG311759)
Chromosome X position(base) 50349832 - 50350420 strand +
Alignment
seq1: chrX_50349832_50350420
seq2: MSMg01-094K09.TJ_50_637

seq1  GAATTCACAGATATGATGAAATTTAGTTATGATTTGGCCAATATTCCTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGATATGATGAAATTTAGTTATGATTTGGCCAATATTCCTTG  50

seq1  AAAACTGCCAGAGCGTAGACAACCAGGTCTTGTAGTCTATTCGGTTTAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTGCCAGAGCGTAGACAACCAGGTCTTGTAGTCTATTCGGTTTAGA  100

seq1  GGATTTTTTGGGATGGGGGCAGGAGCTCTCTATGTAGGTCACCTTGGCCT  150
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  GGATTTTTTGGGATGGGGACAGGAGCTCTCTATGTAGGTCACCTTGGCCT  150

seq1  TTAACTCGTGATTATCCCTGCCTTTGTACCCGAGTGCTGGCATTAGAGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTCGTGATTATCCCTGCCTTTGTACCCGAGTGCTGGCATTAGAGAT  200

seq1  GTGTGACACCATGTGCAGCTTGATGCTTTAGTTCTTACAACACCGTGCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGACACCATGTGCAGCTTGATGCTTTAGTTCTTACAACACCGTGCCA  250

seq1  GGGACTGCTGCTTCTTAGATGGGGCTTAAAAGTTGGGAATGTCATGTAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTGCTGCTTCTTAGATGGGGCTTAAAAGTTGGGAATGTCATGTAAG  300

seq1  ATTGAGTAGTCTAATTCTTCCTGGCTTATTTCTCTCAATAAGTTTTTTTA  350
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ATTGAGTAGTCTAATTCTTCCTGGCTTATTTCTCTCAATAAGTTTTTTAA  350

seq1  AAAAGATTTTTATTTATTATTATAGATAAGTACACTGTTGGCTGTCTTCA  400
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  AAAAGATTTTTATTTATTATTATAGATAAGTACACTGTT-GCTGTCTTCA  399

seq1  GACACACCAGAAGGGGGCATCAGATCTCATTCCAGATGATTGTGAGCCAC  450
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  GACACACCAGAAGAGGGCATCAGATCTCATTCCAGATGATTGTGAGCCAC  449

seq1  CGTGAGGTTGCTGGGATTTGAACTCAGGACCTTCGGAAGAGCAGTCAGTG  500
      ||||||| |||||||||||||||||||||||||||||||||||| |||||
seq2  CGTGAGGCTGCTGGGATTTGAACTCAGGACCTTCGGAAGAGCAGCCAGTG  499

seq1  TTCTTACCCGCTGAGCCATCTCTCCAGCCCCTCTCATTAAGTTTTGATTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TTCTTACCCGCTGAGCCATCTCTCCAGCCCCTCTCATTAAGTTTTGATTT  549

seq1  ATAGATTAACTTATGATCTTTTAAGCTTTTCTTGTAGTT  589
      | ||||||||| |||||||||||  ||||||||||||||
seq2  ACAGATTAACTCATGATCTTTTACCCTTTTCTTGTAGTT  588