Top
IDMSMg01-091J23
Information of forward sequence (DDBJ: AG309522)
Chromosome X position(base) 50437393 - 50438038 strand -
Alignment
seq1: chrX_50437393_50438038
seq2: MSMg01-091J23.T7_50_723 (reverse)

seq1  CAAAGTTACATAGAGAGACCAGATCTCAAAACAGACAGACATACAGGAGG  50
      || ||||||||||||||  | |  |||||||||  |||||||||| ||||
seq2  CAGAGTTACATAGAGAGGGCGGTGCTCAAAACACTCAGACATACAAGAGG  50

seq1  GAAAGAGAGTTATAGCTTATATAACTCTCCGGTGTTAGGGA-------AG  93
      |||||||||||||||||||||||||||||||||||||||||       ||
seq2  GAAAGAGAGTTATAGCTTATATAACTCTCCGGTGTTAGGGAAGCGGGGAG  100

seq1  CGAAGAGCTTTTTAAGCAGGGGAAGAGAAAAGCAAAGGCAATAAAGGAGA  143
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAGATCTTTTTAAGCAGGGGAAGAGAAAAGCAAAGGCAATAAAGGAGA  150

seq1  GGCAGACATGCAAAGCTACAGTGTAGGCAACTCTAGGTCACTTTCTATTT  193
      ||||| ||||||||| ||||||||||||||||||||||||||||||||||
seq2  GGCAGGCATGCAAAGTTACAGTGTAGGCAACTCTAGGTCACTTTCTATTT  200

seq1  TATCATTCCTCATATTTGAGACTTTGAGAAAAAGAAGCCATT-CCTATTT  242
      ||||||||||||||| ||||||| |||||||||||||||||| |||||||
seq2  TATCATTCCTCATATGTGAGACTGTGAGAAAAAGAAGCCATTCCCTATTT  250

seq1  TAACAGAACACATTTGTTCCATGGTCTGCATGCATACTTTGAATATAATG  292
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TAACAGAAAACATTTGTTCCATGGTCTGCATGCATACTTTGAATATAATG  300

seq1  GACCCAGGAACATGTGAGATATTCAGGCATTCCAAACTCATTTGTCTGTC  342
      |  |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCAGGAACATGTGAGATATTCAGGCATTCCAAACTCATTTGTCTGTC  350

seq1  TG--------------------TCTATCTATCTATCTATCTATCTATCTA  372
      ||                    ||||||||||||||||||||||||||||
seq2  TGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA  400

seq1  TCTATCTATCTATCTATCTCTATTCTGTGTGTCTGTATGTGTGTACATGT  422
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCTATCTATCTATCTCTATTCTGTGTGTCTGTATGTGTGTACATGT  450

seq1  GCATATGCATGTGGAGGCTAAAGATCAACATTGGTTGTCTTCTTCAACTG  472
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATGCATGTGGAGGCTAAAGATCAACATTGGTTGTCTTCTTCAACTG  500

seq1  ACAACCATCTTAATTTTTGAGATGGGGCCTTTCACTGCACCTGAACCTCA  522
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACCATCTTAATTTTTGAGATGGGGCCTTTCACTGCACCTGAACCTCA  550

seq1  TCAATTTGGCAAGACAGGCCATCTAGCAAACTCTAGGGATCTTCTGATCT  572
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATTTGGCAAGACAGGCCATCTAGCAAACTCTAGGGATCTTCTGATCT  600

seq1  CCATTACCCCAGCACTAGAATTCTAGGCACTCTACATAGCCAGCTTTCTA  622
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CCATTACCCCAGCACTAGAATTCTAGGCACTCTACGTAGCCAGCTTTCTA  650

seq1  CATGGCTCCTGGAGATTTGAATTC  646
      |||||| || ||||||||||||||
seq2  CATGGCGCCAGGAGATTTGAATTC  674

Information of reverse sequence (DDBJ: AG309523)
Chromosome X position(base) 50349832 - 50350425 strand +
Alignment
seq1: chrX_50349832_50350425
seq2: MSMg01-091J23.TJ_63_655

seq1  GAATTCACAGATATGATGAAATTTAGTTATGATTTGGCCAATATTCCTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGATATGATGAAATTTAGTTATGATTTGGCCAATATTCCTTG  50

seq1  AAAACTGCCAGAGCGTAGACAACCAGGTCTTGTAGTCTATTCGGTTTAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTGCCAGAGCGTAGACAACCAGGTCTTGTAGTCTATTCGGTTTAGA  100

seq1  GGATTTTTTGGGATGGGGGCAGGAGCTCTCTATGTAGGTCACCTTGGCCT  150
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  GGATTTTTTGGGATGGGGACAGGAGCTCTCTATGTAGGTCACCTTGGCCT  150

seq1  TTAACTCGTGATTATCCCTGCCTTTGTACCCGAGTGCTGGCATTAGAGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTCGTGATTATCCCTGCCTTTGTACCCGAGTGCTGGCATTAGAGAT  200

seq1  GTGTGACACCATGTGCAGCTTGATGCTTTAGTTCTTACAACACCGTGCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGACACCATGTGCAGCTTGATGCTTTAGTTCTTACAACACCGTGCCA  250

seq1  GGGACTGCTGCTTCTTAGATGGGGCTTAAAAGTTGGGAATGTCATGTAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTGCTGCTTCTTAGATGGGGCTTAAAAGTTGGGAATGTCATGTAAG  300

seq1  ATTGAGTAGTCTAATTCTTCCTGGCTTATTTCTCTCAATAAGTTTTTTTA  350
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ATTGAGTAGTCTAATTCTTCCTGGCTTATTTCTCTCAATAAGTTTTTTAA  350

seq1  AAAAGATTTTTATTTATTATTATAGATAAGTACACTGTTGGCTGTCTTCA  400
       |||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CAAAGATTTTTATTTATTATTATAGATAAGTACACTGTT-GCTGTCTTCA  399

seq1  GACACACCAGAAGGGGGCATCAGATCTCATTCCAGATGATTGTGAGCCAC  450
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  GACACACCAGAAGAGGGCATCAGATCTCATTCCAGATGATTGTGAGCCAC  449

seq1  CGTGAGGTTGCTGGGATTTGAACTCAGGACCTTCGGAAGAGCAGTCAGTG  500
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CGTGAGGTTGCTGGGATTTGAACTCACGACCTTCGGAAGAGCAGTCAGTG  499

seq1  TTCTTACCCGCTGAGCCATCTCTCCAGCCCCTCTCATTAAGTTTTGATTA  550
      ||||||| ||||||||||||||||||||||||||||||| ||||||||||
seq2  TTCTTACTCGCTGAGCCATCTCTCCAGCCCCTCTCATTACGTTTTGATTA  549

seq1  ATAGATTAACTTATGATCTTTTAAGCTTTTCTTGTAGTTTAGTT  594
       |||||||||||||||||||| |||||| ||||| |||||||||
seq2  CTAGATTAACTTATGATCTTTCAAGCTTCTCTTGCAGTTTAGTT  593