Top
IDMSMg01-073L01
Information of forward sequence (DDBJ: AG296926)
Chromosome X position(base) 50266154 - 50266807 strand +
Alignment
seq1: chrX_50266154_50266807
seq2: MSMg01-073L01.T7_46_695

seq1  GAATTCCAGAGACTTGGCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50
      |||||||||||||||  |||||||||||||||||||||||||||||||||
seq2  GAATTCCAGAGACTTCCCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50

seq1  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100

seq1  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTAGGAGGCTAGTGTGC  150
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTGGGAGGCTAGTGTGC  150

seq1  GATTGGGGAATACATAACGGAGAGAATCCGCTCTGTTTCCTGCCTGGTCC  200
      |||||||||||||||||||||| ||||||||||||||||||| |||||||
seq2  GATTGGGGAATACATAACGGAGGGAATCCGCTCTGTTTCCTGTCTGGTCC  200

seq1  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250

seq1  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300

seq1  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350

seq1  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400

seq1  GTTTCCTTTTGAATAACCGCAAAAAAAAAAAAAAAAAAAGCAGTGCGAAG  450
      ||||||||||||||||||||    |||||||||||||||| ||||| |||
seq2  GTTTCCTTTTGAATAACCGC----AAAAAAAAAAAAAAAGTAGTGCTAAG  446

seq1  CATGTAATAATATCGTGCAACCAAATTCAGGTGCCCTTCCGGTACATTTC  500
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CATGTAATAATATCGTGCAACCAAATTCAGGTGTCCTTCCGGTACATTTC  496

seq1  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGAGAGAAAGACCGTGT  550
      |||||||||||||||||||||||||||||||||||| |||| || |||||
seq2  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGATAGAACGATCGTGT  546

seq1  TATCTTTGGAGGATCGCACTTATATCTGTGAATTTCAACTGGCTTGCATG  600
      |||||||||||||||| ||  ||||||||||| ||  ||||||| || ||
seq2  TATCTTTGGAGGATCGTACCCATATCTGTGAACTTTCACTGGCTCGCTTG  596

seq1  CGGAAGGTTTTTCATCTTCCGGAACTGCAGTTTTGTTTTGTTTGTTTTTT  650
      |   | ||  |||||||||| |||| || ||| ||||||||| | |||||
seq2  CTTGATGTCCTTCATCTTCCCGAACCGCCGTTCTGTTTTGTTCGGTTTTT  646

seq1  TCGG  654
      ||||
seq2  TCGG  650

Information of reverse sequence (DDBJ: AG296927)
Chromosome X position(base) 50402486 - 50403110 strand -
Alignment
seq1: chrX_50402486_50403110
seq2: MSMg01-073L01.TJ_67_691 (reverse)

seq1  CATGGCAACCCCTTTCCTCCTTGCCTAGGGCTCAGTCCTCTCCTGACCTC  50
      ||||||||||||||||||||| ||||| | ||||||||||||||| ||| 
seq2  CATGGCAACCCCTTTCCTCCTAGCCTAAGACTCAGTCCTCTCCTGGCCTT  50

seq1  TCATCTCTGTAATACTCACCCCACCAATTCTTAGGAAGAGGAGTGGCTCC  100
      || | ||  |||||||||  ||| ||||||||||||||||||||||||||
seq2  TCGTATCGATAATACTCAGACCAGCAATTCTTAGGAAGAGGAGTGGCTCC  100

seq1  CAGACCTTTCAGTTATCAATCTGTCACAAGGGCACAGTGGTATCTCGTGA  150
      ||||||||||||||||||||| ||||||||||||||||||||||||| ||
seq2  CAGACCTTTCAGTTATCAATCAGTCACAAGGGCACAGTGGTATCTCGGGA  150

seq1  CATGATGATCCCCGAGACGTCTGAGATCCCTGCATGTGTAACCTCAAATT  200
      ||||||||| |||||||||||||||||||||||||||||| |||||||||
seq2  CATGATGATTCCCGAGACGTCTGAGATCCCTGCATGTGTAGCCTCAAATT  200

seq1  TCTGGATCTCCCAGTACCCTTAAAGACCTTTTAGCGAGTAGCATTTCACA  250
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TCTGGATCTCCCAGGACCCTTAAAGACCTTTTAGCGAGTAGCATTTCACA  250

seq1  ATGGGACACAAATCAAAGCACAACAAAACAAAGAAACAGCAAAACTGTGA  300
      ||||||||||||||||||||||||||| ||||                  
seq2  ATGGGACACAAATCAAAGCACAACAAAGCAAANNNNNNNNNNNNNNNNNN  300

seq1  AGATGGGGAAAAAAAAACAAAACAAATAAGCAGCTAACCAACCTACTACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  AGATGGGGAAAAAAAAACAAAACAAATAAGCAGCTAACCAACCTACTGCA  350

seq1  AATTCTGTTTTTAAAAAGTCTCTTTGTTTTGCAGTTTCTTTCCAGTTTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCTGTTTTTAAAAAGTCTCTTTGTTTTGCAGTTTCTTTCCAGTTTCT  400

seq1  ACTCTACTTTCAGCCACCAGAGTTAGTGTAATTCTGTGGCCTTGATTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTACTTTCAGCCACCAGAGTTAGTGTAATTCTGTGGCCTTGATTTTT  450

seq1  AAAAGCTTGTTATCTTAAGAATGTTTCTAAGTTTCTAGGTAGTTTTTATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCTTGTTATCTTAAGAATGTTTCTAAGTTTCTAGGTAGTTTTTATG  500

seq1  ATTATTCACAATGACTAAAAACGTTCTTTTGAGGATGCCACTAAATTAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATTCACAATGACTAAAAACGTTCTTTTGAGGATGCCACTAAATTAAT  550

seq1  CTCTATGGTTAGTTCATATTTGCTCCCTTAATTTACTTGAGTCTATAGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATGGTTAGTTCATATTTGCTCCCTTAATTTACTTGAGTCTATAGAA  600

seq1  AGGATCAAAGCTTTAAAGTGAATTC  625
      |||||||||||||||||||||||||
seq2  AGGATCAAAGCTTTAAAGTGAATTC  625