Top
IDMSMg01-053A07
Information of forward sequence (DDBJ: AG281354)
Chromosome 16 position(base) 71984505 - 71985032 strand +
Alignment
seq1: chr16_71984505_71985032
seq2: MSMg01-053A07.T7_47_574

seq1  GAATTCTCATATTTCAGGATGAGTAGAATTATTAGCAGAAAATCATCATT  50
      |||||||||||||||  || || || ||||||||||||||||||||||||
seq2  GAATTCTCATATTTCCCGACGAATACAATTATTAGCAGAAAATCATCATT  50

seq1  TCCCACAAATCATGCAACTTTTTATATCAAGGTGTCTTTTAAAATATCAC  100
      ||||||| ||| ||||||||||||||||||||||||||||||||||||||
seq2  TCCCACATATCCTGCAACTTTTTATATCAAGGTGTCTTTTAAAATATCAC  100

seq1  CATCATGCTTAAGTTCTTTGCAACTAAGTTTGATCATTCAATTCATGTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATGCTTAAGTTCTTTGCAACTAAGTTTGATCATTCAATTCATGTTT  150

seq1  CTTTTGTCAACGATATGGAGCATAGCATAGTAAACCGCCAAATTGTCAAT  200
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  CTTTTGTCAACGATATGGAGCATAGCATAGTAAACCGCCAAACTGTCAAT  200

seq1  ATTGCTTATTTATCCCCTTATAGCACATATCCTATACAGGAATTTATAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCTTATTTATCCCCTTATAGCACATATCCTATACAGGAATTTATAAG  250

seq1  ACAACATCCTATTTTTAAAAGTTTTGTTTGTTTGTTTGTGTTGTTTTTAT  300
      |||||||||||||||||||||||||||||||| ||| | |||||||||||
seq2  ACAACATCCTATTTTTAAAAGTTTTGTTTGTTCGTTCGAGTTGTTTTTAT  300

seq1  TTAAATTAGCTTTTTGAGGAAATGAGTTTGTACAGAGCTGAATTATGGGA  350
      |||||||||||||||||||||||||||||| |||||| ||||||||||||
seq2  TTAAATTAGCTTTTTGAGGAAATGAGTTTGCACAGAGTTGAATTATGGGA  350

seq1  TGATAAAACCATCAATATGGAACTATGTACTGAAAGCAAATAAATAATCA  400
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  TGATAAAACCATCAATATGGAACTATGTACTGAAAGCAAATAACTAATCA  400

seq1  AGACACCACTATCAGCTTCTACCATCTTGTGACTCACAATCCTTCCTCAA  450
      ||| ||||||||| |||||||||||||||||||||| |||||||||||| 
seq2  AGATACCACTATCTGCTTCTACCATCTTGTGACTCATAATCCTTCCTCAT  450

seq1  GCTGAGCCATCAAACAGACAACACTGGGATACTCACTATTTAGACTGAAT  500
      |||||||||||| ||| |||||||||| |||||||||||||| |||||||
seq2  GCTGAGCCATCATACATACAACACTGGTATACTCACTATTTACACTGAAT  500

seq1  GCAGAAGCCAATACTAACCTGAACATTT  528
      ||  || |||||||||||||||| ||||
seq2  GCTTAATCCAATACTAACCTGAAAATTT  528

Information of reverse sequence (DDBJ: AG281355)
Chromosome X position(base) 50337505 - 50338119 strand +
Alignment
seq1: chrX_50337505_50338119
seq2: MSMg01-053A07.TJ_107_301

seq1  AATGCTGATTCATAGGGTGGTCACAAGTGAACCAGGAAT--------AAA  42
      |||||||||||| | |||  ||| ||| ||||| |||||        || 
seq2  AATGCTGATTCA-AAGGTAATCAAAAGGGAACCTGGAATCAAAACTGAAT  49

seq1  TCAT---------AAAACATGGGCTTTTGGTCTGCAGGAGATGAGCTAGC  83
      | ||         ||||| ||||||||||||||||| ||||||| |||||
seq2  TGATATGTAAATAAAAACCTGGGCTTTTGGTCTGCATGAGATGAACTAGC  99

seq1  AAAAGGCAATAGCAGTTCTTTTTAGAATTTTTCTCTAGTGAGAACTCAGC  133
      |||| ||||||||||      | ||||  |   |  |    |||| ||| 
seq2  AAAAAGCAATAGCAG------TCAGAAAATCCATAAACAATGAACACAG-  142

seq1  TGTCTGGAGATCTCTGGAGAGCGAACACAGCTCTTCAATTTTTTTTTCTA  183
      | | | || || | |          || ||||| |  |  ||||||||||
seq2  TCTTTTGAAATTTTT----------CATAGCTCATTTAGATTTTTTTCTA  182

seq1  ACAGACTTTCT--TGTTTTAGTCACAAAATCCATGGAGAGAGCATAGCTC  231
      | ||  |||||                                       
seq2  ATAGGATTTCTGA-------------------------------------  195

seq1  TTTTAGAAATTTTCATAGTGTTTTAAGAACTTTTTCTAATAGGTCAGAAA  281
                                                        
seq2  --------------------------------------------------  195

seq1  TCCCAAGAATTACTTAGAGAGTGGATATAGCTCTTTTAGAAGGCTCTCTA  331
                                                        
seq2  --------------------------------------------------  195

seq1  GCTGCTATCCAGAGAAGGCTGTCTGAAGGATTTTTAGAATTCTAAATGTC  381
                                                        
seq2  --------------------------------------------------  195

seq1  TGAAGGCACTTTTAGAATTTTTTTCTGGCTTTCTGATTTTGATCGGAAAA  431
                                                        
seq2  --------------------------------------------------  195

seq1  CCCAAGAATTATTATTATTATTATTATTATTATTATTATTTGGTTTTTCG  481
                                                        
seq2  --------------------------------------------------  195

seq1  AGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCTCTTTGTAG  531
                                                        
seq2  --------------------------------------------------  195

seq1  ACCAGGCTGGCCTCGAACTCAGAAATCTGCCTGTCTCTGCCTCCAAGAAT  581
                                                        
seq2  --------------------------------------------------  195

seq1  TATTTTTAGAATTTTTTTCTAATAGGATTTCTGA  615
                                        
seq2  ----------------------------------  195