Top
IDMSMg01-051I21
Information of forward sequence (DDBJ: AG280278)
Mapping result un_mapped
BAC sequence
Information of reverse sequence (DDBJ: AG280279)
Chromosome X position(base) 50111219 - 50111529 strand +
Alignment
seq1: chrX_50111219_50111529
seq2: MSMg01-051I21.TJ_114_360

seq1  TGTTGGTGTTTGTTTGTTTGTTTTTTGTTTTCC-----CTGAGGGTTCTT  45
      |||||||| |||||||||| || ||| ||||        || ||||| ||
seq2  TGTTGGTG-TTGTTTGTTTTTTGTTTTTTTTTNTGTTTGTGTGGGTTTTT  49

seq1  TTGTTTGGT-TTGGTTTTTGTTTTGTTTTTTTTTTGTTTTGTTTTGTTT-  93
      || ||| || || |||||| ||||||| | | |||||||  |||||||| 
seq2  TTTTTTTGTGTTTGTTTTTCTTTTGTTGTNTGTTTGTTTGTTTTTGTTTT  99

seq1  ---TTTGGTTTTTTTTTAAAGATTTATTTATTTATTATATGTAAGTACAC  140
         ||||||||||||||   | |   ||| ||| || | | |   |    
seq2  TCGTTTGGTTTTTTTTTTTGGTTGGTTTTTTTTGTTTTTTTTTTTTTTTT  149

seq1  TGTAGCTGTCTTCAGACACTCCAGAAGAGGGTGTCAGATCTTGTTACGGA  190
      |||   ||| ||                  ||||  | | ||||      
seq2  TGTTTGTGTTTT------------------GTGT--GTTGTTGT------  173

seq1  TGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTTCGGACCTTCGG  240
        |||||         |||  ||  |||  ||||                
seq2  --GTTGT---------TGTTTTTTTTGGTTTTTG----------------  196

seq1  AAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATTTCACCAGCCCCCTGT  290
                 | || ||||      ||     |||     |     | |
seq2  ----------TGTTGTTCTTGTTTTTTG-----TTTTTGTTG-----TTT  226

seq1  TTTTTGTTTTTTGTTTTTGTT  311
      ||||  |||||||||||||||
seq2  TTTTGTTTTTTTGTTTTTGTT  247