Top
IDB6Ng01-219N06
Information of forward sequence (DDBJ: GA035552)
Mapping result un_mapped
BAC sequence
Information of reverse sequence (DDBJ: GA035553)
Chromosome X position(base) 50402470 - 50403110 strand -
Alignment
seq1: chrX_50402470_50403110
seq2: B6Ng01-219N06.g_63_703 (reverse)

seq1  ATACCCTCCCCCACTCCATGGCAACCCCTTTCCTCCTTGCCTAGGGCTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCCTCCCCCACTCCATGGCAACCCCTTTCCTCCTTGCCTAGGGCTCA  50

seq1  GTCCTCTCCTGACCTCTCATCTCTGTAATACTCACCCCACCAATTCTTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCTCCTGACCTCTCATCTCTGTAATACTCACCCCACCAATTCTTAG  100

seq1  GAAGAGGAGTGGCTCCCAGACCTTTCAGTTATCAATCTGTCACAAGGGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGGAGTGGCTCCCAGACCTTTCAGTTATCAATCTGTCACAAGGGCA  150

seq1  CAGTGGTATCTCGTGACATGATGATCCCCGAGACGTCTGAGATCCCTGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGTATCTCGTGACATGATGATCCCCGAGACGTCTGAGATCCCTGCA  200

seq1  TGTGTAACCTCAAATTTCTGGATCTCCCAGTACCCTTAAAGACCTTTTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTAACCTCAAATTTCTGGATCTCCCAGTACCCTTAAAGACCTTTTAG  250

seq1  CGAGTAGCATTTCACAATGGGACACAAATCAAAGCACAACAAAACAAAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGTAGCATTTCACAATGGGACACAAATCAAAGCACAACAAAACAAAGA  300

seq1  AACAGCAAAACTGTGAAGATGGGGAAAAAAAAACAAAACAAATAAGCAGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGCAAAACTGTGAAGATGGGGAAAAAAAAACAAAACAAATAAGCAGC  350

seq1  TAACCAACCTACTACAAATTCTGTTTTTAAAAAGTCTCTTTGTTTTGCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCAACCTACTACAAATTCTGTTTTTAAAAAGTCTCTTTGTTTTGCAG  400

seq1  TTTCTTTCCAGTTTCTACTCTACTTTCAGCCACCAGAGTTAGTGTAATTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTCCAGTTTCTACTCTACTTTCAGCCACCAGAGTTAGTGTAATTC  450

seq1  TGTGGCCTTGATTTTTAAAAGCTTGTTATCTTAAGAATGTTTCTAAGTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCCTTGATTTTTAAAAGCTTGTTATCTTAAGAATGTTTCTAAGTTT  500

seq1  CTAGGTAGTTTTTATGATTATTCACAATGACTAAAAACGTTCTTTTGAGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGTAGTTTTTATGATTATTCACAATGACTAAAAACGTTCTTTTGAGG  550

seq1  ATGCCACTAAATTAATCTCTATGGTTAGTTCATATTTGCTCCCTTAATTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCACTAAATTAATCTCTATGGTTAGTTCATATTTGCTCCCTTAATTT  600

seq1  ACTTGAGTCTATAGAAAGGATCAAAGCTTTAAAGTGAATTC  641
      |||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGAGTCTATAGAAAGGATCAAAGCTTTAAAGTGAATTC  641