Top
IDB6Ng01-177P23
Information of forward sequence (DDBJ: GA005112)
Chromosome 1 position(base) 37769753 - 37770024 strand +
Alignment
seq1: chr1_37769753_37770024
seq2: B6Ng01-177P23.b_53_324

seq1  ATAGCCACTATGCCTCAAGATCTCCCTGCCAAGATCCAGGTCAGAAACTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCCACTATGCCTCAAGATCTCCCTGCCAAGATCCAGGTCAGAAACTT  50

seq1  CTATCTCCCAGACTCCAGATTAGGATCACTGGAAAGCCTTCCAATTCTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTCCCAGACTCCAGATTAGGATCACTGGAAAGCCTTCCAATTCTGA  100

seq1  ATTGTAGTTCATTCCAGATATAGATAGTCAAATTGACAACCAGGGATAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTAGTTCATTCCAGATATAGATAGTCAAATTGACAACCAGGGATAGC  150

seq1  CACTACAGTGGGTGAGTTTGTCCCTCATCTCCTCATCGCCATTGCCCTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTACAGTGGGTGAGTTTGTCCCTCATCTCCTCATCGCCATTGCCCTTA  200

seq1  GGATATAACTTCTAAGTCACAAGTTGTGTGCATGGGAAGGTCCAAAAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATATAACTTCTAAGTCACAAGTTGTGTGCATGGGAAGGTCCAAAAAGA  250

seq1  GTGTACTGGGGTGGGGGGGGGA  272
      ||||||||||||||||||||||
seq2  GTGTACTGGGGTGGGGGGGGGA  272

Information of reverse sequence (DDBJ: GA005113)
Chromosome X position(base) 50377537 - 50377731 strand -
Alignment
seq1: chrX_50377537_50377731
seq2: B6Ng01-177P23.g_415_525 (reverse)

seq1  TTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAA  50
      |||| ||||||||||||||||||||||| |||||||||||||||      
seq2  TTAAAAGCACTGACTGCTCTTCCAGAGGACCTGAGTTCAATTCC------  44

seq1  ACACATGGTGGCTCACAACACTCAGCAACCACGTGGTGGCTCACAACACT  100
                                                        
seq2  --------------------------------------------------  44

seq1  GAGCAACCACATGGTGGCTCATAACACTCAGCAACCACGTGGTGGCTCAC  150
                                  ||| |||||| |||||||||||
seq2  ----------------------------CAGAAACCACATGGTGGCTCAC  66

seq1  AACCATCTGGAATGGGATTTGATTCCCTCTTGTGGTGTGTCTGAA  195
      |||| |||| ||||||||| ||| ||||||| |||||||||||||
seq2  AACCGTCTGTAATGGGATTGGATGCCCTCTTCTGGTGTGTCTGAA  111