Top
IDB6Ng01-171P17
Information of forward sequence (DDBJ: GA000721)
Chromosome X position(base) 50412016 - 50412951 strand -
Alignment
seq1: chrX_50412016_50412951
seq2: B6Ng01-171P17.b_44_985 (reverse)

seq1  TAGTTTGGAACCTCA-GGAGGGAGC-GGGGACAACTAC--AACAAAACCC  46
      ||| || ||||||||  |||||||| |||||| ||| |  ||||||||||
seq2  TAG-TTAGAACCTCACAGAGGGAGCGGGGGACGACTTCCAAACAAAACCC  49

seq1  ACCAGGTGTCAAG--AAAAAAAAAGGGGGGGGGGCAATTGCAAAACGGGT  94
        ||| |||||||  |||||||||||||||||||||||||||||||||||
seq2  CACAGATGTCAAGAAAAAAAAAAAGGGGGGGGGGCAATTGCAAAACGGGT  99

seq1  AACACATGCGAAAA-CGGCAGGCAGATACTAAAATCACGGATTCTGAATT  143
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AACACATGCGAAAACCGGCAGGCAGATACTAAAATCACGGATTCTGAATT  149

seq1  CCGCGGTGCTCAGCGCTGCAGTTTCTTGCGCTACTCAACTCTCGCTGTAT  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCGGTGCTCAGCGCTGCAGTTTCTTGCGCTACTCAACTCTCGCTGTAT  199

seq1  TTCTATATTTTTACTGTGATACTTCTTCGAGGTTGATCTCATAATCGTGA  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTATATTTTTACTGTGATACTTCTTCGAGGTTGATCTCATAATCGTGA  249

seq1  GTTTTGCGAAAATGATCGCAAAGTTTCAAGGCTTTGCTACAATCGTGTGA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGCGAAAATGATCGCAAAGTTTCAAGGCTTTGCTACAATCGTGTGA  299

seq1  CCTTAGGCTGATGACTGGGGCTTATTTTCGTTGTTTTTGTTTTGTTTTGT  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAGGCTGATGACTGGGGCTTATTTTCGTTGTTTTTGTTTTGTTTTGT  349

seq1  TTTTCTTTCTGGGTTTGGAGGGTGAGAAGACAGGAGGGTAGAGTCTTTCA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTTTCTGGGTTTGGAGGGTGAGAAGACAGGAGGGTAGAGTCTTTCA  399

seq1  GGATCTGTAAAACTGTGGGGAGAAATTAGCCAAAAAGATTTTTACAGAAC  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCTGTAAAACTGTGGGGAGAAATTAGCCAAAAAGATTTTTACAGAAC  449

seq1  AAGATTTTCTTTTCAGGAAAGAGCTCTCTCTCTCTCTCTCTCTCTCTCTC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATTTTCTTTTCAGGAAAGAGCTCTCTCTCTCTCTCTCTCTCTCTCTC  499

seq1  TCTCTCTCTCTCTCTCTCTCTCTCTGTTCTACGGATAATTTCAGATAGTT  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTCTCTCTCTCTCTCTCTCTGTTCTACGGATAATTTCAGATAGTT  549

seq1  TCAGTGTGCACTTAAAACTATTATTAGGACCTACAATTTTTCTATTAATA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGTGCACTTAAAACTATTATTAGGACCTACAATTTTTCTATTAATA  599

seq1  TCTTCACAACACTTTGTGGACCAGACTGAAAGTTTGCCGACCAGCCAGGC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCACAACACTTTGTGGACCAGACTGAAAGTTTGCCGACCAGCCAGGC  649

seq1  GTGACTGACCACGCGGCGACTAAATCCTCGGCTAGATCATTCATAGAGCT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACTGACCACGCGGCGACTAAATCCTCGGCTAGATCATTCATAGAGCT  699

seq1  CCAGTGTCCTTGGGCTGCGATGCTTTCTTTGGGTTTTTAAGGTTCAGCCT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGTCCTTGGGCTGCGATGCTTTCTTTGGGTTTTTAAGGTTCAGCCT  749

seq1  GGTGGGTCAGTTTGTTTGGATTCCTGCACATAAACATTAATTTTCCTACA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGGTCAGTTTGTTTGGATTCCTGCACATAAACATTAATTTTCCTACA  799

seq1  TAAATACCAGAAGATTCCAGCGCTGGGAGATGAAAGATGAATTTGTGACA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATACCAGAAGATTCCAGCGCTGGGAGATGAAAGATGAATTTGTGACA  849

seq1  GGTCTTCTGAAGAAAAATGGCAAGGGCTTTCTTTATTAAACTCCCTTTGC  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTCTGAAGAAAAATGGCAAGGGCTTTCTTTATTAAACTCCCTTTGC  899

seq1  TACATCAGCATATTAAGAGAGCCAGCTGAATATTGATGAATTC  936
      |||||||||||||||||||||||||||||||||||||||||||
seq2  TACATCAGCATATTAAGAGAGCCAGCTGAATATTGATGAATTC  942

Information of reverse sequence (DDBJ: GA000722)
Chromosome X position(base) 50266154 - 50266803 strand +
Alignment
seq1: chrX_50266154_50266803
seq2: B6Ng01-171P17.g_68_719

seq1  GAATTCCAGAGACTTGGCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGAGACTTGGCCAAGGACAATCGGAGGGGGGGGGGACCCCGAC  50

seq1  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGGCTGAAAGGAACCTACTGAAGTGTTGGGAAGGAAGAGACTTTTT  100

seq1  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTAGGAGGCTAGTGTGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGTTTATCCAGCGCCTTGGTTAGAGGGAGATCTAGGAGGCTAGTGTGC  150

seq1  GATTGGGGAATACATAACGGAGAGAATCCGCTCTGTTTCCTGCCTGGTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGGGAATACATAACGGAGAGAATCCGCTCTGTTTCCTGCCTGGTCC  200

seq1  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTACATGGGCGAACAGCACGGCGTTCTTTTGCAGTTTCTATTCGTT  250

seq1  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATATTCTGTGTGAAAGTGAAAAACAAATCTTTTGATGTTTGAAAAGC  300

seq1  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATTTTCCTCTGGTTCCTACGTAATATCGGGTCTTATTCATACAGT  350

seq1  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATTTCTTCACTACCCTTTGGCTTGAAACAACTGGAAAATTCCTTTA  400

seq1  GTTTCCTTTTGAATAACCGCAAAAAAAAAAAAAAAAAAAGCAGTGCGAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCTTTTGAATAACCGCAAAAAAAAAAAAAAAAAAAGCAGTGCGAAG  450

seq1  CATGTAATAATATCGTGCAACCAAATTCAGGTGCCCTTCCGGTACATTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTAATAATATCGTGCAACCAAATTCAGGTGCCCTTCCGGTACATTTC  500

seq1  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGAGAGAAAGACCGTGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTCATTTATTTCTCTTCACTGCAACTTTGCTGAGAGAAAGACCGTGT  550

seq1  TATCTTTGGAGGATCGCACTTATATCTGTGAATTTCAACTGGCTTGCATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTTTGGAGGATCGCACTTATATCTGTGAATTTCAACTGGCTTGCATG  600

seq1  CGGAAGG-TTTTTCATCTTCCGGAAC-TGCAGTTTTGTTTTGTTTGTTTT  648
      ||||||| |||||||||||||||||| ||||||||| |||||||||||||
seq2  CGGAAGGTTTTTTCATCTTCCGGAACTTGCAGTTTTTTTTTGTTTGTTTT  650

seq1  TT  650
      ||
seq2  TT  652