Top
IDB6Ng01-149C06
Information of forward sequence (DDBJ: DH945560)
Chromosome X position(base) 50232324 - 50233466 strand +
Alignment
seq1: chrX_50232324_50233466
seq2: B6Ng01-149C06.b_45_1180

seq1  GAATTCTCAGTTCCTGCACCATGCTTACCTGGATGCTACCATGTTCTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCAGTTCCTGCACCATGCTTACCTGGATGCTACCATGTTCTGCC  50

seq1  TTAATGATAATGGACTGAACCTCTGAACCTGTAAGTCAGTCCCAATTAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATGATAATGGACTGAACCTCTGAACCTGTAAGTCAGTCCCAATTAAA  100

seq1  TGTTGCCTTGTTCATGGTGTCTGTTCACAGCAGTAAAACCCTAACTAACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCCTTGTTCATGGTGTCTGTTCACAGCAGTAAAACCCTAACTAACT  150

seq1  AAGACAGCCATCACCTACCATAAGAGTTCTATGGAGGAGGAGTAGCATAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGCCATCACCTACCATAAGAGTTCTATGGAGGAGGAGTAGCATAT  200

seq1  TGTGAACCTTAGGTTGGACTGGGACAAATGCCCTAAGTTGGCCTGGAGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAACCTTAGGTTGGACTGGGACAAATGCCCTAAGTTGGCCTGGAGAC  250

seq1  TTTGCAGCCTTAGGCCGAGCTGGAGCATGAGTGGAGAGGAACTCAGAGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCAGCCTTAGGCCGAGCTGGAGCATGAGTGGAGAGGAACTCAGAGAG  300

seq1  GGCCTCTCTTAAGCACTGTACTCTCCACCCGAGTGCTGTGAAGTTGGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTCTCTTAAGCACTGTACTCTCCACCCGAGTGCTGTGAAGTTGGAGA  350

seq1  AGCTGGAACCAAGTCCCCGGGAGTCTCAGGACATGAAAGCCCTGCAGATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGGAACCAAGTCCCCGGGAGTCTCAGGACATGAAAGCCCTGCAGATA  400

seq1  GAACTAGAGTAGTTTGCCAAACTGCTGAAGCAGAAGAGGATCAGTTTGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAGAGTAGTTTGCCAAACTGCTGAAGCAGAAGAGGATCAGTTTGGG  450

seq1  GTACAACCAGGCCAACATGGGGCTCACCCTGGGTGTTCTCTTTGGAGAAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAACCAGGCCAACATGGGGCTCACCCTGGGTGTTCTCTTTGGAGAAG  500

seq1  TGTTCAGCCAGACCACCATCTGCAGCTTTAAGGCCCTGCAGCTCAGCTTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCAGCCAGACCACCATCTGCAGCTTTAAGGCCCTGCAGCTCAGCTTC  550

seq1  AAGAGCTTGTGTAAACTGCGGCCCCTGCTGGAGAAGTGGGTGGAGGAAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCTTGTGTAAACTGCGGCCCCTGCTGGAGAAGTGGGTGGAGGAAGC  600

seq1  GGACAACAATGAGGATGTTCAAGGATGTATTGCAAACCCTGGTGTAGGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAACAATGAGGATGTTCAAGGATGTATTGCAAACCCTGGTGTAGGCC  650

seq1  TGCAAGAGAAAGCAGATGAGCATTGAGAACCCTGAGAAGGGGAACCTGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAGAGAAAGCAGATGAGCATTGAGAACCCTGAGAAGGGGAACCTGAA  700

seq1  AAACACATTTCTGCAGTGGCGGAAGCCTACCCTGCAGCAGGTCAGCAGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACATTTCTGCAGTGGCGGAAGCCTACCCTGCAGCAGGTCAGCAGCA  750

seq1  TCATCAAACAGCTTGGGCTGGAGAAGGATGTGGCCCGGGTGTGGTTCTGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAAACAGCTTGGGCTGGAGAAGGATGTGGCCCGGGTGTGGTTCTGT  800

seq1  AACCTGCACCAGGAGGGTAAACAAATGATCAAGCATCGACTATTCCCAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTGCACCAGGAGGGTAAACAAATGATCAAGCATCGACTATTCCCAAC  850

seq1  AAGTACGAAGCTGCAGGGCCTCCTTTGGGGGAGACCTATATCCTTTCCTT  900
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  AAGTACGAAGCTGCAGGGCCTCCTTTGGGGGAGACCTATATCCTTT-CTT  899

seq1  TGCTTCCAGGGCCTCATTTTGGTGCCCCGGGGTATGGGAACCCCCATTTC  950
      ||||||||||| |||||||||||| |||||||||||||||||||||||||
seq2  TGCTTCCAGGG-CTCATTTTGGTG-CCCGGGGTATGGGAACCCCCATTTC  947

seq1  ACCACACTGTAC-ACATTGGTCCCTTTTTGCAAGGATAAGGCCTCTCCCT  999
      |||||||||||| |||||||||| ||||||||| ||||||||   ||| |
seq2  ACCACACTGTACAACATTGGTCCTTTTTTGCAA-GATAAGGCTCTTCCTT  996

seq1  CTGTTCCTGTCACTGCTCTAGGCTCTCCCATGTATTCAAGCTGAGGCGAC  1049
      |||||| |||||||||||||||||||||  |||| ||||||||||   ||
seq2  CTGTTCTTGTCACTGCTCTAGGCTCTCCATTGTAATCAAGCTGAGCGAAC  1046

seq1  ATCCCTGCCTGGGGGTGAGGTGAGCCTAGGGGAAGAAGGTGGATAAAGAG  1099
      ||||||| |||||||||||||||||||| |||||||| ||||||||||| 
seq2  ATCCCTG-CTGGGGGTGAGGTGAGCCTA-GGGAAGAA-GTGGATAAAGA-  1092

seq1  AGCCTGGAGCCACCACGG-CTTTGGAGTTAAGTTCACTGACTGAG  1143
      ||| |||||||||||||| ||||||||||||| ||||||||||||
seq2  AGCTTGGAGCCACCACGGCCTTTGGAGTTAAG-TCACTGACTGAG  1136

Information of reverse sequence
Mapping result no_insert
BAC sequence