Top
IDB6Ng01-107H11
Information of forward sequence (DDBJ: DH914929)
Chromosome 2 position(base) 117711275 - 117711647 strand -
Alignment
seq1: chr2_117711275_117711647
seq2: B6Ng01-107H11.b_201_573 (reverse)

seq1  GCCGGGGCCTAGCAAACACAGAAGTGGATGCTTACAGTCAGCTAATGGAT  50
      |||||||||||||||||||||||||||||||| ||||||| ||| |||||
seq2  GCCGGGGCCTAGCAAACACAGAAGTGGATGCTCACAGTCAACTATTGGAT  50

seq1  GGATCACAGGGCTCCCAATGGAGGAGCTAGAGAAAGTACCCAAGGAGCTA  100
      |||||||||||| ||||||||||||||||||||||||| |||||||||||
seq2  GGATCACAGGGCCCCCAATGGAGGAGCTAGAGAAAGTATCCAAGGAGCTA  100

seq1  AAGGGATCTGCAACCCTATAGGTGGATCAACATTATGAACTAACCAGTAC  150
      ||| ||||||||||||||| |||||| |||||||||||||||||||||||
seq2  AAGAGATCTGCAACCCTATCGGTGGAACAACATTATGAACTAACCAGTAC  150

seq1  CCTGGAGCTCTTGACTCTAGCTGCATATGTATCAAAAGATGGCCTAGTCG  200
      ||  ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGAGCTCTTGACTCTAGCTGCATATGTATCAAAAGATGGCCTAGTCG  200

seq1  GCCATCACTGGAAAGAGAGGCCCACTGGACACGCAAACTTTATATGCCCC  250
      ||||||| |||||||||||||||| ||| || ||||||||||||||||||
seq2  GCCATCAGTGGAAAGAGAGGCCCATTGGTCAGGCAAACTTTATATGCCCC  250

seq1  AGTACAGGGGAACGCCAGGGCCAAAAAGGGGGAGTGGGTGGGTAGGGGAG  300
      |||||||||||||||||||||||||||  |||| ||||||||||||||||
seq2  AGTACAGGGGAACGCCAGGGCCAAAAAATGGGAATGGGTGGGTAGGGGAG  300

seq1  TGGGGGTGGGTGGGTATGGGGGACTTTTGGTATAGCATTGGAAATGTAAA  350
      |||||| ||| |||| |||||||||||| | |||||||||||||||||| 
seq2  TGGGGGGGGGAGGGTGTGGGGGACTTTTTGGATAGCATTGGAAATGTAAT  350

seq1  TGAGCTAAATACCTAATAAAAAA  373
      ||||  |||||| ||||||||||
seq2  TGAGGAAAATACGTAATAAAAAA  373

Information of reverse sequence (DDBJ: DH914930)
Chromosome X position(base) 50320190 - 50321087 strand -
Alignment
seq1: chrX_50320190_50321087
seq2: B6Ng01-107H11.g_68_966 (reverse)

seq1  ATCAATCCTC-TCTTTTTAAAAATCCATCC-ATCTTTCCTTCCTTCCTTC  48
      |||||  ||| |||| | ||||||||| || ||| ||| |||||||||| 
seq2  ATCAACTCTCTTCTTATAAAAAATCCAACCAATCATTCTTTCCTTCCTTA  50

seq1  CATCTAATTACATGTATGTGCATGTGTGGGCATGCTTGTGCCATTTGTCT  98
      ||| |||| |||||||||||||||||||||||||||||||||||||||| 
seq2  CATTTAATAACATGTATGTGCATGTGTGGGCATGCTTGTGCCATTTGTC-  99

seq1  TTGTCTGTGTGTCTATCTATCCACCTATCTATCTATCTATCTATCTATCT  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCTGTGTGTCTATCTATCCACCTATCTATCTATCTATCTATCTATCT  149

seq1  ATCTATCTATCTATCTATCTTTTATCCTGCCCATAATTCCAACACTTAGG  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTATCTATCTATCTATCTTTTATCCTGCCCATAATTCCAACACTTAGG  199

seq1  AGACGGAGGAAGGAGGATTGCCATGAGTTTGAGGCCAGCCTGGATTACAT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACGGAGGAAGGAGGATTGCCATGAGTTTGAGGCCAGCCTGGATTACAT  249

seq1  AGTACATTCCAGGCCATTCTGAGCTACAGTATAAAACCCTGACTCAAAAG  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACATTCCAGGCCATTCTGAGCTACAGTATAAAACCCTGACTCAAAAG  299

seq1  CAAGCAAAGGCCTTCTAATCCATCCATCCATTGAAGTATATATTTGTTCA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCAAAGGCCTTCTAATCCATCCATCCATTGAAGTATATATTTGTTCA  349

seq1  TGTGTGGGCCATCTGTCTATATCTATACTATATATTTATTACATGTGTGT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGGGCCATCTGTCTATATCTATACTATATATTTATTACATGTGTGT  399

seq1  TAGTGTATGGGCATCCACGTGCCATGGCACGTGTACAAAGATCAAAGGAC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGTATGGGCATCCACGTGCCATGGCACGTGTACAAAGATCAAAGGAC  449

seq1  AACTTGCAGAGTTGTTTTGGTTTAAAGCCATTTGTAGAGTTTCTCCTCTT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGCAGAGTTGTTTTGGTTTAAAGCCATTTGTAGAGTTTCTCCTCTT  499

seq1  CTGCTCTGTCCATGTACTTCAGATTTCAATCCTTTCATTTTCTTTTGAGA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTGTCCATGTACTTCAGATTTCAATCCTTTCATTTTCTTTTGAGA  549

seq1  GCAGTGGTTGGCCTTCGTCCTCAACTGGATTAGAAGGTTATTTGTGACTA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGGTTGGCCTTCGTCCTCAACTGGATTAGAAGGTTATTTGTGACTA  599

seq1  TGCTGGCCTGACTTCCCCTTCCCCAATTTTCCTCTATTCCTGGGTCCCAC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGCCTGACTTCCCCTTCCCCAATTTTCCTCTATTCCTGGGTCCCAC  649

seq1  ATGTCTAATTGTAACTTCTTCACCTCTACTTATGTAGATTTCTCTAATAC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCTAATTGTAACTTCTTCACCTCTACTTATGTAGATTTCTCTAATAC  699

seq1  TCCCTCACGCCTCATAATTTCACTTTCTTCTTTTTACTCTCAGCCACTCT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCACGCCTCATAATTTCACTTTCTTCTTTTTACTCTCAGCCACTCT  749

seq1  GGCAAAGTTTGCAGTACCTGTTGTAAAGACCAGTGGCGCTTTCTAATTGT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAAGTTTGCAGTACCTGTTGTAAAGACCAGTGGCGCTTTCTAATTGT  799

seq1  TCCCTTACTTCTTGGCTCTAATTTTTATTCCCAAATGGTTTAAGTGCTGT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTTACTTCTTGGCTCTAATTTTTATTCCCAAATGGTTTAAGTGCTGT  849

seq1  CACTGGGTCCTCTACTAACCTACTTTGCCAAAGACCCAAAAATAGAATTC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGGTCCTCTACTAACCTACTTTGCCAAAGACCCAAAAATAGAATTC  899