Top
IDB6Ng01-102F22
Information of forward sequence (DDBJ: DH911282)
Chromosome X position(base) 50632703 - 50633835 strand +
Alignment
seq1: chrX_50632703_50633835
seq2: B6Ng01-102F22.b_43_1170

seq1  GAATTCACCATTTTACATAGTCAAAGCTTTTGACCTTGGTATTTTTACTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCATTTTACATAGTCAAAGCTTTTGACCTTGGTATTTTTACTA  50

seq1  ATAAATGACATTCGCAAAGCATAGCAGGATATTTGACTTGCTAGTTTTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATGACATTCGCAAAGCATAGCAGGATATTTGACTTGCTAGTTTTTG  100

seq1  TTTTGAGAGTCCCAGGAATGGAACTTAAAGTCTCTAACATACTAGGCAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGAGAGTCCCAGGAATGGAACTTAAAGTCTCTAACATACTAGGCAAA  150

seq1  CTCAATGCCACTGAACGATATCCTCAGCCTAGAAACTTCTTAGAAACAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAATGCCACTGAACGATATCCTCAGCCTAGAAACTTCTTAGAAACAGT  200

seq1  AAGACTGTTTTACAGAGTTCACATTTAGGAAATTCACTTCTGTAAGTAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACTGTTTTACAGAGTTCACATTTAGGAAATTCACTTCTGTAAGTAAT  250

seq1  GTTTCCGGAAAGGTAAACTTTTCTATACATGGAATTTGATATGAAAGTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCGGAAAGGTAAACTTTTCTATACATGGAATTTGATATGAAAGTAG  300

seq1  AAAATCACTTGGAATCTATGTAGCAGTGTTGAGCAAACTACAGATAGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCACTTGGAATCTATGTAGCAGTGTTGAGCAAACTACAGATAGAAT  350

seq1  AGTTCCCTGCTAGATGTAGCTTGGACAGTAGTCGGACACTAAGAATTTGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCCTGCTAGATGTAGCTTGGACAGTAGTCGGACACTAAGAATTTGA  400

seq1  GGCATGAGTAAAGGAATATGGTGCATATGCGACTGGAAATCTAAGACAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGAGTAAAGGAATATGGTGCATATGCGACTGGAAATCTAAGACAGG  450

seq1  GAAATGAATTTGACCAAGGCTCAGTACCATCCTACTTTAGACCAATTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGAATTTGACCAAGGCTCAGTACCATCCTACTTTAGACCAATTCTT  500

seq1  CCTTCAGAGTAAGACTCTGACTTCACCCTAGCTTTTAAATATGCCATAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAGAGTAAGACTCTGACTTCACCCTAGCTTTTAAATATGCCATAAA  550

seq1  CAACAAAAAGTGCTCACATAGGCAAGTCTCTGACTTCATGCATGTGAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAAAAGTGCTCACATAGGCAAGTCTCTGACTTCATGCATGTGAGTG  600

seq1  AGACATGTTTCCCATGGTGTATCAAACGCTTTGATAGCTGAGGGAGGTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATGTTTCCCATGGTGTATCAAACGCTTTGATAGCTGAGGGAGGTGG  650

seq1  GTCATACTTGTAATCTCAGCATTTGGAAGGTTGGGGCAGAAGGATCACTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATACTTGTAATCTCAGCATTTGGAAGGTTGGGGCAGAAGGATCACTA  700

seq1  TGATTTCTTTATACTCTCAAACTCCACTTAGTTAACTTAATTTCTAATGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTCTTTATACTCTCAAACTCCACTTAGTTAACTTAATTTCTAATGT  750

seq1  CAAAACTTTGGACAGAGTCTTACAGATCAGGCTTTGTTTAAACCGGTGAT  800
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CAAAACTTTGGACAGAGTCTTACAGATCACGCTTTGTTTAAACCGGTGAT  800

seq1  CTTTTGCCTCCACCTCCTAAGTGTTGGGATTAGAGATTTACATCACCATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGCCTCCACCTCCTAAGTGTTGGGATTAGAGATTTACATCACCATA  850

seq1  CTTGGCTTCAAGGTTTTTAAATAACCTTTTCTCTGGCCCTTATTTATATG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGCTTCAAGGTTTTTAAATAACCTTTTCTCTGGCCCTTATTTATATG  900

seq1  CTTAGAAGTCTGGATAGTGGTGTGACTCTCCAGTAGAGTACTTGCCTAGC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGAAGTCTGGATAGTGGTGTGACTCTCCAGTAGAGTACTTGCCTAGC  950

seq1  ATGGATGAGAAACTGGATTGATCCCCAGCCTCACACACAGGCAAACAAAT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGATGAGAAACTGGATTGATCCCCAGCCTCACACACAGGCAAACAAAT  1000

seq1  ATACAAACCTACCTGAGCTGCAAAGTGAGTTCAAAGCGACCTAGGCAACT  1050
      ||||||||||||||||||||| ||||||||||||||||||||| ||||||
seq2  ATACAAACCTACCTGAGCTGC-AAGTGAGTTCAAAGCGACCTA-GCAACT  1048

seq1  CCGTGAATAAAAAAGAGGACTGAGAATGTAG-CTCACTTGGCCAGCACGT  1099
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  CCGTGAATAAAAAAGAGGACTGAGAATGTAGCCTCACTTGGCCAGCACGT  1098

seq1  GCTAGGTACTGGATTCAATCCCCACCATCAAAGT  1133
      |||| |||||||||   ||||||| |||||||||
seq2  GCTA-GTACTGGAT--CATCCCCA-CATCAAAGT  1128

Information of reverse sequence (DDBJ: DH911283)
Mapping result un_mapped
BAC sequence