Top
IDB6Ng01-102F16
Information of forward sequence (DDBJ: DH911272)
Chromosome X position(base) 50632703 - 50633880 strand +
Alignment
seq1: chrX_50632703_50633880
seq2: B6Ng01-102F16.b_45_1211

seq1  GAATTCACCATTTTACATAGTCAAAGCTTTTGACCTTGGTATTTTTACTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCATTTTACATAGTCAAAGCTTTTGACCTTGGTATTTTTACTA  50

seq1  ATAAATGACATTCGCAAAGCATAGCAGGATATTTGACTTGCTAGTTTTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATGACATTCGCAAAGCATAGCAGGATATTTGACTTGCTAGTTTTTG  100

seq1  TTTTGAGAGTCCCAGGAATGGAACTTAAAGTCTCTAACATACTAGGCAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGAGAGTCCCAGGAATGGAACTTAAAGTCTCTAACATACTAGGCAAA  150

seq1  CTCAATGCCACTGAACGATATCCTCAGCCTAGAAACTTCTTAGAAACAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAATGCCACTGAACGATATCCTCAGCCTAGAAACTTCTTAGAAACAGT  200

seq1  AAGACTGTTTTACAGAGTTCACATTTAGGAAATTCACTTCTGTAAGTAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACTGTTTTACAGAGTTCACATTTAGGAAATTCACTTCTGTAAGTAAT  250

seq1  GTTTCCGGAAAGGTAAACTTTTCTATACATGGAATTTGATATGAAAGTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCGGAAAGGTAAACTTTTCTATACATGGAATTTGATATGAAAGTAG  300

seq1  AAAATCACTTGGAATCTATGTAGCAGTGTTGAGCAAACTACAGATAGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCACTTGGAATCTATGTAGCAGTGTTGAGCAAACTACAGATAGAAT  350

seq1  AGTTCCCTGCTAGATGTAGCTTGGACAGTAGTCGGACACTAAGAATTTGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCCTGCTAGATGTAGCTTGGACAGTAGTCGGACACTAAGAATTTGA  400

seq1  GGCATGAGTAAAGGAATATGGTGCATATGCGACTGGAAATCTAAGACAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGAGTAAAGGAATATGGTGCATATGCGACTGGAAATCTAAGACAGG  450

seq1  GAAATGAATTTGACCAAGGCTCAGTACCATCCTACTTTAGACCAATTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGAATTTGACCAAGGCTCAGTACCATCCTACTTTAGACCAATTCTT  500

seq1  CCTTCAGAGTAAGACTCTGACTTCACCCTAGCTTTTAAATATGCCATAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAGAGTAAGACTCTGACTTCACCCTAGCTTTTAAATATGCCATAAA  550

seq1  CAACAAAAAGTGCTCACATAGGCAAGTCTCTGACTTCATGCATGTGAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAAAAGTGCTCACATAGGCAAGTCTCTGACTTCATGCATGTGAGTG  600

seq1  AGACATGTTTCCCATGGTGTATCAAACGCTTTGATAGCTGAGGGAGGTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATGTTTCCCATGGTGTATCAAACGCTTTGATAGCTGAGGGAGGTGG  650

seq1  GTCATACTTGTAATCTCAGCATTTGGAAGGTTGGGGCAGAAGGATCACTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATACTTGTAATCTCAGCATTTGGAAGGTTGGGGCAGAAGGATCACTA  700

seq1  TGATTTCTTTATACTCTCAAACTCCACTTAGTTAACTTAATTTCTAATGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTCTTTATACTCTCAAACTCCACTTAGTTAACTTAATTTCTAATGT  750

seq1  CAAAACTTTGGACAGAGTCTTACAGATCAGGC-TTTGTTTAAACCGGTGA  799
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  CAAAACTTTGGACAGAGTCTTACAGATCAGGCTTTTGTTTAAACCGGTGA  800

seq1  TCTTTTGCCTCCACCTCCTAAGTGTTGGGATTAGAGATTTACATCACCAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTGCCTCCACCTCCTAAGTGTTGGGATTAGAGATTTACATCACCAT  850

seq1  ACTTGGCTTCAAGGTTTTTAAATAACCTTTTCTCTGGCCCTTATTTATAT  899
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ACTTGGCTTCAAGGTTTTTAAATAACCTTTTCTCTGGCTCTTATTTATAT  900

seq1  GCTTAGAAGTCTGGATAGTGGTGTGACTC-TCCAGTAGAGTACTTGCCTA  948
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GCTTAGAAGTCTGGATAGTGGTGTGACTCTTCCAGTAGAGTACTTGCCTA  950

seq1  GCATGGATGAGAAACTGGATTGATCCCCAGCCTCACACACAGGCAAACAA  998
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  GCATGGATGAGAAACTGGAATGATCCCCAGCCTCACACACAGGCAAACAA  1000

seq1  ATATACAAACCTACCTGAGCTGCAAAGTGAGTTCAAAGCGACCTAGGCAA  1048
      ||||||||||||||||||||||| ||||||| ||||||||||||||   |
seq2  ATATACAAACCTACCTGAGCTGC-AAGTGAG-TCAAAGCGACCTAG--CA  1046

seq1  CTCCGTGAATAAAAAAGAGGACT-GAGAATGTAGCTCACTTGGCCAGCAC  1097
      || ||||||| ||||||| |||| ||||||||||||||||| ||||||||
seq2  CT-CGTGAAT-AAAAAGA-GACTGGAGAATGTAGCTCACTT-GCCAGCAC  1092

seq1  GTGCTAGGTACTGGATTCAATCCCCACCATCAAAGTAAAATAATAAATAA  1147
      |||||| ||||||||||| |||||||||||||| || ||||||||| |||
seq2  GTGCTA-GTACTGGATTC-ATCCCCACCATCAAGGT-AAATAATAATTAA  1139

seq1  CATATTGAAAATTGGGGTCAATAATATTTGA  1178
      | ||| ||||  |||||||||| ||||||||
seq2  C-TATGGAAA--TGGGGTCAATTATATTTGA  1167

Information of reverse sequence (DDBJ: DH911273)
Mapping result un_mapped
BAC sequence