Top
IDB6Ng01-066N04
Information of forward sequence (DDBJ: DH885891)
Chromosome X position(base) 50717075 - 50718191 strand -
Alignment
seq1: chrX_50717075_50718191
seq2: B6Ng01-066N04.b_46_1149 (reverse)

seq1  AGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCT  50
      |||| | |||||| |||||||||||||||||||| ||||| ||||||| |
seq2  AGGT-CAGAGTTC-AATCCCAGCAACCACATGGT-GCTCA-AACCATCGT  46

seq1  TAACAAAACCTGATGCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGT  100
      | |||||| |||||| |||||| ||||| ||| |||||||||||||||||
seq2  T-ACAAAA-CTGATG-CCTCTT-TGGAGGGTC-GAAGACAGCTACAGTGT  91

seq1  ACTTACATATAATAAATAAATAAATCTTTTTTAAAAAAAGATATTTTCCC  150
      |||||||||||||||||||||||||||||||  |||||||||||||||||
seq2  ACTTACATATAATAAATAAATAAATCTTTTT--AAAAAAGATATTTTCCC  139

seq1  AGACTTGCACAGGGCATTAGGGACAGAAATATATTGTCTACTCATATCCT  200
      ||||||||||||||||||| ||||||||||||| ||||||||||||||||
seq2  AGACTTGCACAGGGCATTA-GGACAGAAATATA-TGTCTACTCATATCCT  187

seq1  TTATAGTATTTATTTCCTCAGCATCTCAATTAGAAGGCCCTACCCCTGCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAGTATTTATTTCCTCAGCATCTCAATTAGAAGGCCCTACCCCTGCC  237

seq1  TTCTGCTTCCCTTCCGTTGCCTCTGAGTCAATCTGGGCCAGCAGTGTTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCTTCCCTTCCGTTGCCTCTGAGTCAATCTGGGCCAGCAGTGTTTA  287

seq1  TAAACCATGAGGCTCCAACATGCCCCTGACCATAAAGGCAGGCAGTCCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCATGAGGCTCCAACATGCCCCTGACCATAAAGGCAGGCAGTCCTG  337

seq1  CTGTGAAAAGATGTGGGAAAGTGCCTAGTCTTTGACCCTCTCCCTGAAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGAAAAGATGTGGGAAAGTGCCTAGTCTTTGACCCTCTCCCTGAAAG  387

seq1  TACAGAACATTCATTCCTAATTAAAATTAGAAAGAAAACCTTATGTGTAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAACATTCATTCCTAATTAAAATTAGAAAGAAAACCTTATGTGTAC  437

seq1  ACACCACCTTGTGACTGATTTAAAACTGCTCTCCCACAGGATGCAATGTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCACCTTGTGACTGATTTAAAACTGCTCTCCCACAGGATGCAATGTA  487

seq1  AACACTGGGTGTTTTATCCTGCTTGTCTGAGGCAGGGGTTTGCTATCTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTGGGTGTTTTATCCTGCTTGTCTGAGGCAGGGGTTTGCTATCTAG  537

seq1  CCCATGCTAGGTTCAAACTACAGGTCTTCCTGCTCCTGCCTTCTGAATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATGCTAGGTTCAAACTACAGGTCTTCCTGCTCCTGCCTTCTGAATGC  587

seq1  AGGGATCACTGGTGGATGCCACCAGATCTGCTGTTGGTCCAAAGAAGCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATCACTGGTGGATGCCACCAGATCTGCTGTTGGTCCAAAGAAGCTC  637

seq1  CTTGCCCACAGTTGGGATCATTTGCTGTTTTCCTCACTTTGCATTGAACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCCACAGTTGGGATCATTTGCTGTTTTCCTCACTTTGCATTGAACA  687

seq1  GAGAAAGGATAAGACAAGACTCTGGAATGAGCAGGGGAGTTTCTATAGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAGGATAAGACAAGACTCTGGAATGAGCAGGGGAGTTTCTATAGAC  737

seq1  TTCAACACTATAGATTTAGAACACCGGGACTATCATTTAGCAAGCAAGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAACACTATAGATTTAGAACACCGGGACTATCATTTAGCAAGCAAGGA  787

seq1  AACTATATTGAAGTGTATTCTCCCCGTCCCCTTTTAGGAAAATGGAGCCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTATATTGAAGTGTATTCTCCCCGTCCCCTTTTAGGAAAATGGAGCCC  837

seq1  CCATGGGAATTACTAACCCATCTGCGTAGCCACAGAGGACCAGCTACTTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGGGAATTACTAACCCATCTGCGTAGCCACAGAGGACCAGCTACTTA  887

seq1  AACTCCGCACTTTTCTCTGGCGTTAGATACTGATTCTGTTTCTCAGCCCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCGCACTTTTCTCTGGCGTTAGATACTGATTCTGTTTCTCAGCCCC  937

seq1  TCCTTTACTTTTATCTCAGTACAGGAGCTATCTTAGTCCTCCACCACCGG  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTACTTTTATCTCAGTACAGGAGCTATCTTAGTCCTCCACCACCGG  987

seq1  GTACTAAAAACCAAGAAAATGCAAATTAGGTAAGAGTAATAAATTTTACT  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTAAAAACCAAGAAAATGCAAATTAGGTAAGAGTAATAAATTTTACT  1037

seq1  GCTTTAGACTCTAGTATAAAAGCCCTTTCTCCTTCATGTTGAAAACCTAG  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTAGACTCTAGTATAAAAGCCCTTTCTCCTTCATGTTGAAAACCTAG  1087

seq1  CAACAAAGTATGAATTC  1117
      |||||||||||||||||
seq2  CAACAAAGTATGAATTC  1104

Information of reverse sequence (DDBJ: DH885892)
Chromosome X position(base) 50603278 - 50604313 strand +
Alignment
seq1: chrX_50603278_50604313
seq2: B6Ng01-066N04.g_66_1100

seq1  GAATTCTTAATATAAAAAAAAAAATCAATCAAAGTACCATACAAGGCATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAATATAAAAAAAAAAATCAATCAAAGTACCATACAAGGCATA  50

seq1  CTTCTAAATTATGCTCAAACTCTTGATGTTCACAAATACTAAATATAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTAAATTATGCTCAAACTCTTGATGTTCACAAATACTAAATATAAAA  100

seq1  AGGCATAATTCCAGCTTTGTAGTTAGCAATGTTCCCTTCATTCTGTTGAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATAATTCCAGCTTTGTAGTTAGCAATGTTCCCTTCATTCTGTTGAC  150

seq1  AGTGACTTCAAGATTTTGTAATTTTAGGGGGAAAAAAAGGAAATAAAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACTTCAAGATTTTGTAATTTTAGGGGGAAAAAAAGGAAATAAAAAG  200

seq1  TATGCCCAAATGGACACAAAGCCTAAATGGATTTACATTCAAAGTTCTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCCCAAATGGACACAAAGCCTAAATGGATTTACATTCAAAGTTCTAA  250

seq1  TTTAATTTATACTTCAAAGACGTCAGTTTTAAAGATTATTAAGTAGCACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTTATACTTCAAAGACGTCAGTTTTAAAGATTATTAAGTAGCACA  300

seq1  TAAACTTTAAAGACTATAAAATGCATCTTTTCCTTCTCTTTGTGGTATGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACTTTAAAGACTATAAAATGCATCTTTTCCTTCTCTTTGTGGTATGG  350

seq1  GACAGGGAATAAAGAAAAGTTTAAAAAGATGAGATCATATCTGCTAGTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGGAATAAAGAAAAGTTTAAAAAGATGAGATCATATCTGCTAGTTA  400

seq1  TCAGATCTTTGAGATACTCTCTAAAAGAAAGAGTCCTTACTTTCATTATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGATCTTTGAGATACTCTCTAAAAGAAAGAGTCCTTACTTTCATTATC  450

seq1  AAGTATACTGCCATATTTAGCAGCAGAAATAAGGACACAGGTGGTTCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTATACTGCCATATTTAGCAGCAGAAATAAGGACACAGGTGGTTCCTA  500

seq1  TCTCTGGCCCCATCTCTAAGAATATGGATGTCTGATTTTGACCAATTGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGGCCCCATCTCTAAGAATATGGATGTCTGATTTTGACCAATTGAA  550

seq1  CTGCATTAAGAGACAGATGTTTCTGAAAATGCAGAATCGCGATTCAATAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCATTAAGAGACAGATGTTTCTGAAAATGCAGAATCGCGATTCAATAT  600

seq1  TAAGAGTAACTCACACAAAATGTATTCACTGTAGACATAAATGTCAGCAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGTAACTCACACAAAATGTATTCACTGTAGACATAAATGTCAGCAT  650

seq1  CCTTAGTATATGAGGTGCCCCACAGATCTTAACACAA-TTTTAAGCTTTA  699
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CCTTAGTATATGAGGTGCCCCACAGATCTTAACACAATTTTTAAGCTTTA  700

seq1  GGATCCTTTGAGACTTCACAAATTCAACCAAAAACATTACTTGAAAGTTA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCCTTTGAGACTTCACAAATTCAACCAAAAACATTACTTGAAAGTTA  750

seq1  ATTAACTGCCTTTGCAAGGCTTGTGTATGCATTTGTATGTGGAGTGCATT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAACTGCCTTTGCAAGGCTTGTGTATGCATTTGTATGTGGAGTGCATT  800

seq1  CATGTGTGTGCACATGAATATTCATGTTCATCACTGCTCATGTAGAGACC  849
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CATGTGTGTGCACATGAATATTCATGTTCTTCACTGCTCATGTAGAGACC  850

seq1  AGAGGCCGGAGGATGTTGGCTGGGCTGCTTTAGCACTGTCTTATCCCTAG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCCGGAGGATGTTGGCTGGGCTGCTTTAGCACTGTCTTATCCCTAG  900

seq1  AGTTTCCAGTTTCCTGGCTATGCTGGCTAATCAGTAAGCACCAG-TAAAG  948
      ||||||||| |||||||||||||||||||||||||||||| ||| |||||
seq2  AGTTTCCAG-TTCCTGGCTATGCTGGCTAATCAGTAAGCAACAGTTAAAG  949

seq1  CATCTGTTTCTCCCCTCTCCCAGCACTGGAGTTATAGGCCTGTGTGGCCA  998
      ||||||||||| ||||||||||||||| ||||   |||||||||||| ||
seq2  CATCTGTTTCTTCCCTCTCCCAGCACT-GAGTATAAGGCCTGTGTGG-CA  997

seq1  CACCTGGCTTTTATGTAGGTGCTGCGGATGTACTGTGT  1036
      ||||||||||||||||||||||||||||||||||| ||
seq2  CACCTGGCTTTTATGTAGGTGCTGCGGATGTACTGAGT  1035