Top
IDB6Ng01-056N19
Information of forward sequence (DDBJ: DH878895)
Chromosome X position(base) 50481119 - 50482132 strand -
Alignment
seq1: chrX_50481119_50482132
seq2: B6Ng01-056N19.b_49_1062 (reverse)

seq1  CCACCCCCACCCCCCGC-TTTGTTTTGTTTTGGTCCCGGGCCTGCTGGTC  49
      ||||||||||||||| |  |||||||||||||||||||||||||||||||
seq2  CCACCCCCACCCCCCCCGCTTGTTTTGTTTTGGTCCCGGGCCTGCTGGTC  50

seq1  AGAGCTAATTTGTACAGCTGCTTTTTCGTTTGGTTTCTTCCAAGAAAGAG  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTAATTTGTACAGCTGCTTTTTCGTTTGGTTTCTTCCAAGAAAGAG  100

seq1  AGAGGAAATAAGGTTGCCAGCAAATCTGCAGTTACCAAGGTTTCCCTAAG  149
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGAGGAAATAAGGTTGCCAGCAAATCTGCAGTTACCAAGG-TTCCCTAAG  149

seq1  ATGAATATTATTTTTCTCTTCTAATTCCACCAAATACAGTATAAAGAAAA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATATTATTTTTCTCTTCTAATTCCACCAAATACAGTATAAAGAAAA  199

seq1  GCATGTGACTATTCCACAAATTTAGTTATGCCAGAGGGTCAAATCCTGTA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGTGACTATTCCACAAATTTAGTTATGCCAGAGGGTCAAATCCTGTA  249

seq1  CTCTGTCCACGTCCTGCTGTTGGGAGACATATAATGCTGATTTCCTAACC  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTCCACGTCCTGCTGTTGGGAGACATATAATGCTGATTTCCTAACC  299

seq1  CACTATTTAGGAAAATTGTACTGTAGTTGCAGAATGGTAAATTCCCCTGA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTATTTAGGAAAATTGTACTGTAGTTGCAGAATGGTAAATTCCCCTGA  349

seq1  TTTTGTGCTTAGATTCTCAGACTTGGCTCGTCCTGAGTTTCAGCAGAAAT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTGCTTAGATTCTCAGACTTGGCTCGTCCTGAGTTTCAGCAGAAAT  399

seq1  GTGAAAGGCACTGCTTTGGAGAGGCTAGGGAAATGGGAGAAGTCAGGCAG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAAGGCACTGCTTTGGAGAGGCTAGGGAAATGGGAGAAGTCAGGCAG  449

seq1  GAGAAATCTCAAGGAGTAGGTATTTGGAGCATCAGATTCTGTTTTATGCT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAATCTCAAGGAGTAGGTATTTGGAGCATCAGATTCTGTTTTATGCT  499

seq1  CTGCCACTGACATGCTCTGTGACACAGTCAAGTTACTTCTTACGAAACAT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCACTGACATGCTCTGTGACACAGTCAAGTTACTTCTTACGAAACAT  549

seq1  TTTCCAGGGGGATCAGAGTGGCATATGCTCAAAGGCTCTTTCCAATCAAA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAGGGGGATCAGAGTGGCATATGCTCAAAGGCTCTTTCCAATCAAA  599

seq1  AATTATTGGACCCTGTAAATTAGGGTTTGGGGTTTCTATAAAGGCTAGTC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTATTGGACCCTGTAAATTAGGGTTTGGGGTTTCTATAAAGGCTAGTC  649

seq1  AAGCTAGGTGTAGTAACACATGCTTATAATCTCAGCACTAGGGAGGCAGG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTAGGTGTAGTAACACATGCTTATAATCTCAGCACTAGGGAGGCAGG  699

seq1  GACAGGAGGATCACAAGGTTGAAGCCAGCTTAGACTTTTAGTGAGACTCT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGAGGATCACAAGGTTGAAGCCAGCTTAGACTTTTAGTGAGACTCT  749

seq1  GTCTTTAAATAGAAATTTAAAGCCAATAAGAAAAGTCCCAAAGGTTTGTG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTTAAATAGAAATTTAAAGCCAATAAGAAAAGTCCCAAAGGTTTGTG  799

seq1  GGTATTAACAAGGCTTTCTTCCACTGATCTATCCTTATGAGACATTTGTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATTAACAAGGCTTTCTTCCACTGATCTATCCTTATGAGACATTTGTC  849

seq1  CAAGTTCTTGGTTCTCATTTTTATAGTCTGAGAAGAACTGTCTAAAGAGA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTTCTTGGTTCTCATTTTTATAGTCTGAGAAGAACTGTCTAAAGAGA  899

seq1  CTGTTCATGTTCTTACTGAAGTAGTAGCTGGTATGAGAGGCCAGTTTTTT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTCATGTTCTTACTGAAGTAGTAGCTGGTATGAGAGGCCAGTTTTTT  949

seq1  AAAGCTTCATTGGGATATATGTTACACACCATGCAATCAATGTACCCTTT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCTTCATTGGGATATATGTTACACACCATGCAATCAATGTACCCTTT  999

seq1  TAAAGTATGGAATTC  1014
      |||||||||||||||
seq2  TAAAGTATGGAATTC  1014

Information of reverse sequence (DDBJ: DH878896)
Chromosome X position(base) 50340437 - 50341473 strand +
Alignment
seq1: chrX_50340437_50341473
seq2: B6Ng01-056N19.g_69_1090

seq1  GAATTCACAGTTGTAATTCTCCTACCTCTGTAGTGCTGGGATTACACATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGTTGTAATTCTCCTACCTCTGTAGTGCTGGGATTACACATA  50

seq1  TGTGTCGCCACACCTGACTAAAATCAACATGTAAGAAATGGCATCTTATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCGCCACACCTGACTAAAATCAACATGTAAGAAATGGCATCTTATT  100

seq1  TGGTAATATATGAATCTCTATCAGCATTTCTTTTGTGTGTGTTGCAGTCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAATATATGAATCTCTATCAGCATTTCTTTTGTGTGTGTTGCAGTCA  150

seq1  TGTGCAAGATGTCTTTCTCCATCCCTATTCCACCTTAACAATTTTTATTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCAAGATGTCTTTCTCCATCCCTATTCCACCTTAACAATTTTTATTT  200

seq1  TGAAGCAAGATCTTAATTGTCTGGGTAGGTCGAATATGTATGTGATTCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCAAGATCTTAATTGTCTGGGTAGGTCGAATATGTATGTGATTCTC  250

seq1  CTTTCTTGGTAGCTGGGCATAAAAGCCTTTTTTTTTTTTTTAAACCATAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTTGGTAGCTGGGCATAAAAGCCTTTTTTTTTTTTTTAAACCATAC  300

seq1  TTGGCTTAAAATGCTCATTTTATGTAAAGGCAAAAAGCATTTTAGGGTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCTTAAAATGCTCATTTTATGTAAAGGCAAAAAGCATTTTAGGGTCT  350

seq1  ATTTCTCCTAAGGTTACTAAGTAGTTTATTTTTCCTTTTGGATTGGTACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTCCTAAGGTTACTAAGTAGTTTATTTTTCCTTTTGGATTGGTACT  400

seq1  CCACTTTGTAGACCAGACTGGCCTTGAACTCAGAAATCCGCCTGCCTCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTTTGTAGACCAGACTGGCCTTGAACTCAGAAATCCGCCTGCCTCTG  450

seq1  CCTCCTAAATGCTGGGATTAAAGGCGTGCGCCACCACCGCCCGGCTGGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTAAATGCTGGGATTAAAGGCGTGCGCCACCACCGCCCGGCTGGAT  500

seq1  CTCAAATCTTATGACTAAGTAAAAATTTGTGAAAGAACTGGGCCTAAATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAATCTTATGACTAAGTAAAAATTTGTGAAAGAACTGGGCCTAAATC  550

seq1  TTGAGGAATCACATCATGATTTAGAGCTGTTTAGACTCATGAGGAGGGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGAATCACATCATGATTTAGAGCTGTTTAGACTCATGAGGAGGGAG  600

seq1  AAAAATGCGGAGTGATTATCTGGGAATCCTCTGGGAGACGACAGAGGGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATGCGGAGTGATTATCTGGGAATCCTCTGGGAGACGACAGAGGGCC  650

seq1  TGGGGGCTGCGGTATGGCCAGTACCATTTTCTTCAGAAAGAAAATTATCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGCTGCGGTATGGCCAGTACCATTTTCTTCAGAAAGAAAATTATCA  700

seq1  GGCCCACCTAGTCAGATAAGAGTTCCGGAACTGCCTTTGGTGGCGCGCGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCACCTAGTCAGATAAGAGTTCCGGAACTGCCTTTGGTGGCGCGCGC  750

seq1  GCGGGAGAACGCCCAGCGGAGCCTCCGGGGACGGAGCCTGGGCGGGCCGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGGAGAACGCCCAGCGGAGCCTCCGGGGACGGAGCCTGGGCGGGCCGA  800

seq1  GAGGGCGGGCCGAGGGGCGGAGCCTGGCCGGCAGCGTTTCTGAGCCATTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGCGGGCCGAGGGGCGGAGCCTGGCCGGCAGCGTTTCTGAGCCATTG  850

seq1  CTGAGGCGGCGAGGGAGAGCGTTGGGCTTACCTCACTGCTTTCCGGAGCG  900
      |||||||||||||||||||||||||||||||||||||||||| | |||||
seq2  CTGAGGCGGCGAGGGAGAGCGTTGGGCTTACCTCACTGCTTT-CAGAGCG  899

seq1  GTAGCACCTCCTCCGCCGGCTTCCTCCTCAGACCGCTTTTTGCCGCGAGC  950
      ||||||| ||||||| ||||||||| |||||||||| |||||||||||||
seq2  GTAGCACTTCCTCCG-CGGCTTCCT-CTCAGACCGC-TTTTGCCGCGAGC  946

seq1  CGACCGGTCCCGTCATGCCGACCCGCAGTCCCAGCGTCGTGGTGAGCCAA  1000
      |||||| |||||||||||||||||||||| |||||||||||||||||   
seq2  CGACCGTTCCCGTCATGCCGACCCGCAGT-CCAGCGTCGTGGTGAGC---  992

seq1  GGGGACTCCAGCAGAGCCCCACAGCCGGGCCCCATGC  1037
        ||||||     ||||||||||||   | |||||||
seq2  -AGGACTC---ACGAGCCCCACAGC---GGCCCATGC  1022