Top
IDB6Ng01-052L09
Information of forward sequence (DDBJ: DH875981)
Chromosome X position(base) 50132155 - 50133284 strand +
Alignment
seq1: chrX_50132155_50133284
seq2: B6Ng01-052L09.b_45_1158

seq1  GAATTCTTACTATACACATAATGCAGAAAGACAGCTTCAATCAGGAAATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTACTATACACATAATGCAGAAAGACAGCTTCAATCAGGAAATG  50

seq1  AAATTTTATGAGAGTAATAGATGAACAAGGAAGAGTCCAGAAGAAATCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTTATGAGAGTAATAGATGAACAAGGAAGAGTCCAGAAGAAATCCA  100

seq1  TCATGCCTGACACAGTAAACCAGCAAAATTCCCCTACTAATAACTGAGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCCTGACACAGTAAACCAGCAAAATTCCCCTACTAATAACTGAGAA  150

seq1  AGAAAAGATCAAACAATAGTTCAACCAACCAGAAAAACAACCAACAAAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAGATCAAACAATAGTTCAACCAACCAGAAAAACAACCAACAAAAT  200

seq1  TTTTCAAATTACTGACCATCTCTCCATAATAACTTTAAACAATCAAAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAAATTACTGACCATCTCTCCATAATAACTTTAAACAATCAAAAAA  250

seq1  AAAAAACCAAAAAACAAACCAAACAAGAAAACTTTAAACAAAATGGCCGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACCAAAAAACAAACCAAACAAGAAAACTTTAAACAAAATGGCCGC  300

seq1  AGGTCACCAATAAAGAGATATGGACTCCTAATTTCAGGAAGCAAATAATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCACCAATAAAGAGATATGGACTCCTAATTTCAGGAAGCAAATAATA  350

seq1  ATGTACATACAATATCAAATGATTTCATTACTCCACTCTCACATAACATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTACATACAATATCAAATGATTTCATTACTCCACTCTCACATAACATA  400

seq1  GACAGGTTCTAGATTACAAAGCAAATCTTAATGTGTAAGATTCTTTTGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGTTCTAGATTACAAAGCAAATCTTAATGTGTAAGATTCTTTTGTA  450

seq1  TCTTATAGGGTCATAGTGGACTAAACTAGGAATGAGTAACTAGAGAAATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATAGGGTCATAGTGGACTAAACTAGGAATGAGTAACTAGAGAAATG  500

seq1  ATATAAATATATGGAGACTGAATGATGCATCGCTGAGTGACTGAGAGGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAATATATGGAGACTGAATGATGCATCGCTGAGTGACTGAGAGGTC  550

seq1  ATTGAAGATATCATGGAGGACATTTAATAATTCCTAGTATTAAATGAAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGAAGATATCATGGAGGACATTTAATAATTCCTAGTATTAAATGAAAG  600

seq1  GGAAAGCATAGTCACACAGCCATTGGAAGAAGTTAACAGTTCTAAGAGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGCATAGTCACACAGCCATTGGAAGAAGTTAACAGTTCTAAGAGGT  650

seq1  TTTGGCTGACTTAAGACTTTTACTTGTATCCTCTTTAAGGTCAGCAATCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGCTGACTTAAGACTTTTACTTGTATCCTCTTTAAGGTCAGCAATCA  700

seq1  CATCTACCAGTAAACTTTTGAAGTATTTATCCTGTGTTTTCCCTATCTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTACCAGTAAACTTTTGAAGTATTTATCCTGTGTTTTCCCTATCTCA  750

seq1  GTAAACTATTGAAATCTCTGGAATTTAGTAACTGTATTTGAAATCATAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACTATTGAAATCTCTGGAATTTAGTAACTGTATTTGAAATCATAGA  800

seq1  GATCCCAAATAAATAACATAAGGATGGACCTCAAGGGCTTAGAAAAGCAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCCAAATAAATAACATAAGGATGGACCTCAAGGGCTTAGAAAAGCAA  850

seq1  GAACAAAGCAAATCCAAAAAGTAGTAGACAGCAAGAAATAATAAAGTTCA  900
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GAACAAAGCAAATCCAAAAAGTAGTAGACAGCAAGAAAT-ATAAAGTTCA  899

seq1  AGGCAAGAATTAATAAATGGAGGGGAGGGGGCTGGAGAGATGGCTCGGCG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAAGAATTAATAAATGGAGGGGAGGGGGCTGGAGAGATGGCTCGGCG  949

seq1  GATAAGAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCA  1000
      ||||||||||||||||||||||||||| |||||||||   ||||||||||
seq2  GATAAGAGCACTGACTGCTCTTCTGAA-GTCCTGAGT--CAATCCCAGCA  996

seq1  ACCACATGGTGGCTCACAACCACCCGTAATGAGATCTGATGCCTCTTTCT  1050
      | ||||||||||||||||  || |||||||||||||||||||||||||||
seq2  A-CACATGGTGGCTCACA--CA-CCGTAATGAGATCTGATGCCTCTTTCT  1042

seq1  GGTGCGTTTGAAGATAGCTACAGTGTACTTATGTATAATAATAAATCTTA  1100
      ||||||||||||| |||||||||||||||||| ||| |||    ||||||
seq2  GGTGCGTTTGAAG-TAGCTACAGTGTACTTAT-TAT-ATA--TCATCTTA  1087

seq1  AAAAATAATAAAATGGAAGCTAAAAGAGCA  1130
      || ||||||||| ||  |||| ||||||||
seq2  AAGAATAATAAATTG--AGCT-AAAGAGCA  1114

Information of reverse sequence (DDBJ: DH875982)
Mapping result un_mapped
BAC sequence