Top
IDB6Ng01-019G18
Information of forward sequence (DDBJ: DH852510)
Chromosome X position(base) 50101325 - 50102388 strand +
Alignment
seq1: chrX_50101325_50102388
seq2: B6Ng01-019G18.b_41_1095

seq1  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAACAATTTGTATAGGAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTGTAGTTCTTGGGTACCAAGCAACAATTTGTATAGGAAAA  50

seq1  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATATTGCCAAAACATAAAAATTGGGGTTCATAGTGACTATCTAAGTA  100

seq1  CTATTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTTTTGCAACAGCACATATAACCAACATAAAATAAGCAATATACTG  150

seq1  TTAACTAAATAATATCAGTGTGAATTTGATATTAAAGATTTATCCTTTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTAAATAATATCAGTGTGAATTTGATATTAAAGATTTATCCTTTGA  200

seq1  TGAGGAAAAGAAAGCCTCACTGTATACAATTTGATAGCAAAACGCTGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGAAAAGAAAGCCTCACTGTATACAATTTGATAGCAAAACGCTGAAA  250

seq1  GCTAAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAAAAAATAAATTTATACACTTTTGAAAGATTTCTTCAAAGACTACGT  300

seq1  GACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGAAAGAGGTGAATCAACTTTCTGAAATATGAATATGTTTAAATACC  350

seq1  TGTTATTAATTTTCTTGTAAACAAACTTTTCTTTTTTAAAGTGGTTTTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTATTAATTTTCTTGTAAACAAACTTTTCTTTTTTAAAGTGGTTTTTG  400

seq1  TCAACATTTGATTTTTTAAAGTGTGTCTTACATTCTTACATTATTTACAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACATTTGATTTTTTAAAGTGTGTCTTACATTCTTACATTATTTACAA  450

seq1  ACATTTCTTATTTTTATTACTATGTGAATTTTGTTTTCAATTACAAAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTCTTATTTTTATTACTATGTGAATTTTGTTTTCAATTACAAAAAT  500

seq1  ATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTAGATAGAATTAAATTACCTCCTTGCCAAGTCAGTACCACAGCGTT  550

seq1  GGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACTAGCAGTTATATGCCATGAATTTGCTTAATATGTGATACTTTCCA  600

seq1  ATTACATTATCTGTGGATCATTTTTTTTCTCTCTCAGCAAGCAGAAGTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACATTATCTGTGGATCATTTTTTTTCTCTCTCAGCAAGCAGAAGTCA  650

seq1  TAAACAAGTTTCCTGGGACAAACAACTGTATTTTTACAACTTTAATATTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACAAGTTTCCTGGGACAAACAACTGTATTTTTACAACTTTAATATTT  700

seq1  TAAGTCAAAGTGGATAGGCAAACATTACAAATATATAAGAATATACTAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTCAAAGTGGATAGGCAAACATTACAAATATATAAGAATATACTAAT  750

seq1  TTCCATCAGTAGGGAAAAAGGTTTTTAAAGTAATTCTCCTACCTTGGGAA  800
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TTCCATCAGTAGGGAAAAAGGTTTTTAAAGTATTTCTCCTACCTTGGGAA  800

seq1  TAGACTCAGTAGATGTTACAGTCATTCAGTATTAAGATTAAGTAGTGGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACTCAGTAGATGTTACAGTCATTCAGTATTAAGATTAAGTAGTGGTT  850

seq1  TTTGTTTTGTTTTTGTTTTTGTTTTTTGTTTTTTTAAATTAATTTTTAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||  ||
seq2  TTTGTTTTGTTTTTGTTTTTGTTTTTTGTTTTTTTAAATTAATTTT--AA  898

seq1  AAAATTTTATTAGGTATTTTCCTCATTTACATTGCCAATGCTATCCCAAT  950
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  AAAATTTTATTAGGTATTTTCCTCATTTACATTGCC-ATGCTATCCCAAT  947

seq1  AAGTAGTGTTAAAGGTATTTTTACACTCTGTTTGGACCACTTTGATTTCC  1000
      |  ||||||||||||||||||||||||||||||||| |||||||| ||||
seq2  AGTTAGTGTTAAAGGTATTTTTACACTCTGTTTGGA-CACTTTGA-TTCC  995

seq1  CTGTTAATGTGATCTTAGAAGTGGAGCTTCTGGTATCACAAACCATAAAA  1050
      |||||||||||||||||| |||||||| ||||||||||| |||||| |||
seq2  CTGTTAATGTGATCTTAG-AGTGGAGC-TCTGGTATCAC-AACCATTAAA  1042

seq1  TTGTTAGCAGACTG  1064
      ||| ||||||||||
seq2  TTG-TAGCAGACTG  1055

Information of reverse sequence (DDBJ: DH852511)
Mapping result un_mapped
BAC sequence